Mutagenetix > Incidental Mutations

Incidental Mutation 'R3725:Uggt1'

270708

Institutional Source

Beutler Lab

Gene Symbol

Uggt1

Ensembl Gene

ENSMUSG00000037470

Gene Name

UDP-glucose glycoprotein glucosyltransferase 1

Synonyms

Ugcgl1, C820010P03Rik, A930007H10Rik, 0910001L17Rik

MMRRC Submission

040716-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.491) question?

Stock #

R3725 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36140027-36244720 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 36182507 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 43 (L43*)

Ref Sequence

ENSEMBL: ENSMUSP00000134078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046875] [ENSMUST00000173166] [ENSMUST00000174266]

Predicted Effect

probably null
Transcript: ENSMUST00000046875
AA Change: L660*

SMART Domains

Protein: ENSMUSP00000037930
Gene: ENSMUSG00000037470
AA Change: L660*

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
Pfam:UDP-g_GGTase	44	1222	N/A	PFAM
SCOP:d1ga8a_	1256	1521	3e-45	SMART
Blast:BROMO	1414	1453	3e-17	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000173166
AA Change: L43*

Predicted Effect

probably benign
Transcript: ENSMUST00000174142

SMART Domains

Protein: ENSMUSP00000133929
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
Pfam:UDP-g_GGTase	1	52	7.8e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174266

SMART Domains

Protein: ENSMUSP00000134640
Gene: ENSMUSG00000037470

Domain	Start	End	E-Value	Type
signal peptide	1	42	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174716

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.5%

Validation Efficiency

96% (55/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UDP-glucose:glycoprotein glucosyltransferase (UGT) is a soluble protein of the endoplasmic reticulum (ER) that selectively reglucosylates unfolded glycoproteins, thus providing quality control for protein transport out of the ER.[supplied by OMIM, Oct 2009]
PHENOTYPE: Heterozygous KO reduces susceptibility to and morbidity of RNA virus infection. Homozygous KO is embryonic lethal. The peptide is a folding sensor for glycoproteins in the ER. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam8	T	A	7: 139,983,868	R740S	possibly damaging	Het
Adamtsl3	A	C	7: 82,612,404	D1676A	possibly damaging	Het
Atp6v1a	A	G	16: 44,101,757		probably benign	Het
Camsap3	T	C	8: 3,603,785	L485P	probably damaging	Het
Ccdc81	A	T	7: 89,866,630	F614I	possibly damaging	Het
Cdk5rap2	C	A	4: 70,235,437	K1716N	possibly damaging	Het
Cfh	T	C	1: 140,086,496	M1197V	probably damaging	Het
Cyp3a11	A	G	5: 145,866,000	F228L	probably benign	Het
Ddx24	A	G	12: 103,417,605	M575T	probably benign	Het
Dhx36	A	T	3: 62,488,222		probably benign	Het
Dmxl2	T	A	9: 54,393,769	I1554L	probably damaging	Het
Dsp	A	G	13: 38,194,689		probably null	Het
Dsp	A	G	13: 38,197,618	S2181G	probably benign	Het
Epg5	T	C	18: 78,017,679	I1959T	probably benign	Het
Fam135a	T	A	1: 24,057,434	K77*	probably null	Het
Fam208b	T	C	13: 3,590,538	I200V	probably benign	Het
Fam209	T	C	2: 172,473,995	S97P	probably benign	Het
Fbxo11	A	G	17: 88,009,286	V323A	probably benign	Het
Fzd5	A	G	1: 64,736,339	S88P	probably damaging	Het
Galnt12	A	T	4: 47,104,140	T133S	probably damaging	Het
Gja8	A	G	3: 96,919,845	L167P	probably damaging	Het
Gm7173	T	A	X: 79,510,015	T285S	probably damaging	Het
Gm8730	T	C	8: 102,865,032		noncoding transcript	Het
Gsdmd	A	G	15: 75,866,090	D247G	probably benign	Het
Iqcg	A	G	16: 33,020,539		probably null	Het
Lamb1	C	T	12: 31,321,075	A1375V	probably null	Het
Mlip	A	G	9: 77,190,380	S282P	probably damaging	Het
Nfxl1	A	T	5: 72,517,062	D831E	probably damaging	Het
Nipbl	T	C	15: 8,295,661	D2506G	probably damaging	Het
Olfr1355	T	A	10: 78,879,932	Y253*	probably null	Het
Olfr805	A	T	10: 129,723,115	V143D	probably damaging	Het
Pcdhb9	T	C	18: 37,401,601	L216P	possibly damaging	Het
Pigc	G	A	1: 161,971,291	G281R	possibly damaging	Het
Polr3g	C	T	13: 81,694,635	R87H	probably damaging	Het
Ppfia4	T	C	1: 134,313,711	D502G	probably benign	Het
Psg18	T	A	7: 18,354,823		probably benign	Het
Rad9a	G	A	19: 4,197,695	R179C	probably damaging	Het
Rxra	A	G	2: 27,754,277	D327G	probably damaging	Het
Samd7	T	C	3: 30,751,134	V22A	possibly damaging	Het
Slc22a29	A	T	19: 8,218,609	V22D	possibly damaging	Het
Slmap	C	A	14: 26,427,242	R671S	probably damaging	Het
Smarcal1	T	C	1: 72,626,596	F751S	possibly damaging	Het
Smarcb1	T	A	10: 75,916,786	K73N	probably benign	Het
Sptssa	T	C	12: 54,656,395	E30G	probably damaging	Het
Stpg2	A	G	3: 139,317,477	K418R	probably benign	Het
Tmem19	A	G	10: 115,359,770		probably benign	Het
Tmem59l	A	G	8: 70,487,301	L6S	unknown	Het
Tmod1	T	C	4: 46,097,026	V273A	probably benign	Het
Tnrc6c	C	T	11: 117,723,529	R838W	probably damaging	Het
Vmn1r205	A	T	13: 22,592,501	F144I	probably damaging	Het
Vmn2r54	G	A	7: 12,632,296	T237I	probably benign	Het
Vmn2r7	A	T	3: 64,724,991	F17I	possibly damaging	Het
Vpreb3	G	A	10: 75,943,291		probably null	Het
Vps13d	T	A	4: 145,115,648		probably benign	Het
Zkscan5	A	T	5: 145,220,913	R742W	probably damaging	Het

Other mutations in Uggt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Uggt1	APN	1	36179552	splice site	probably benign
IGL00817:Uggt1	APN	1	36185932	missense	probably benign	0.03
IGL01395:Uggt1	APN	1	36155077	missense	probably damaging	1.00
IGL01609:Uggt1	APN	1	36182474	missense	probably damaging	1.00
IGL01619:Uggt1	APN	1	36161694	missense	probably damaging	0.99
IGL02077:Uggt1	APN	1	36176794	missense	probably damaging	0.99
IGL02313:Uggt1	APN	1	36184484	missense	probably damaging	0.99
IGL02341:Uggt1	APN	1	36164519	makesense	probably null
IGL02346:Uggt1	APN	1	36179670	missense	probably benign	0.00
IGL02447:Uggt1	APN	1	36150142	missense	probably damaging	1.00
IGL02883:Uggt1	APN	1	36177615	missense	probably benign	0.03
IGL02930:Uggt1	APN	1	36157456	missense	probably benign	0.01
IGL03153:Uggt1	APN	1	36202818	missense	possibly damaging	0.94
IGL03162:Uggt1	APN	1	36207956	missense	probably damaging	1.00
IGL03170:Uggt1	APN	1	36163261	missense	probably damaging	1.00
IGL03266:Uggt1	APN	1	36150048	missense	probably damaging	1.00
K3955:Uggt1	UTSW	1	36162353	missense	probably benign	0.37
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0037:Uggt1	UTSW	1	36185932	missense	probably benign	0.03
R0167:Uggt1	UTSW	1	36170197	critical splice donor site	probably null
R0373:Uggt1	UTSW	1	36179670	missense	probably benign	0.00
R0502:Uggt1	UTSW	1	36159946	missense	probably damaging	1.00
R0546:Uggt1	UTSW	1	36195971	missense	probably benign	0.00
R0610:Uggt1	UTSW	1	36165506	splice site	probably benign
R0671:Uggt1	UTSW	1	36155128	missense	probably damaging	1.00
R0760:Uggt1	UTSW	1	36161724	missense	possibly damaging	0.68
R0825:Uggt1	UTSW	1	36158143	missense	probably benign	0.01
R0827:Uggt1	UTSW	1	36156313	critical splice acceptor site	probably null
R0884:Uggt1	UTSW	1	36175078	missense	probably benign	0.00
R1112:Uggt1	UTSW	1	36173546	missense	possibly damaging	0.54
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1470:Uggt1	UTSW	1	36176796	missense	probably benign	0.13
R1592:Uggt1	UTSW	1	36202858	missense	probably benign	0.04
R1730:Uggt1	UTSW	1	36221261	missense	probably benign	0.05
R1923:Uggt1	UTSW	1	36179613	missense	probably damaging	0.99
R1970:Uggt1	UTSW	1	36151781	missense	probably damaging	1.00
R2086:Uggt1	UTSW	1	36192414	missense	probably null	1.00
R2829:Uggt1	UTSW	1	36162294	missense	probably benign	0.38
R3431:Uggt1	UTSW	1	36210059	nonsense	probably null
R3432:Uggt1	UTSW	1	36210059	nonsense	probably null
R3880:Uggt1	UTSW	1	36176804	intron	probably benign
R4052:Uggt1	UTSW	1	36164489	missense	probably damaging	0.98
R4133:Uggt1	UTSW	1	36158159	missense	probably damaging	1.00
R4489:Uggt1	UTSW	1	36146668	nonsense	probably null
R4570:Uggt1	UTSW	1	36150073	missense	probably damaging	1.00
R4866:Uggt1	UTSW	1	36202855	nonsense	probably null
R4895:Uggt1	UTSW	1	36156264	missense	probably damaging	1.00
R4900:Uggt1	UTSW	1	36202855	nonsense	probably null
R5372:Uggt1	UTSW	1	36244060	splice site	probably benign
R5385:Uggt1	UTSW	1	36184412	missense	probably damaging	1.00
R5652:Uggt1	UTSW	1	36216153	nonsense	probably null
R5694:Uggt1	UTSW	1	36179656	missense	probably damaging	1.00
R5732:Uggt1	UTSW	1	36161771	splice site	probably null
R5893:Uggt1	UTSW	1	36227628	splice site	probably null
R6191:Uggt1	UTSW	1	36162208	missense	probably damaging	0.98
R6247:Uggt1	UTSW	1	36163228	missense	probably damaging	1.00
R6259:Uggt1	UTSW	1	36234916	missense	probably benign	0.00
R6399:Uggt1	UTSW	1	36163366	missense	possibly damaging	0.90
R6439:Uggt1	UTSW	1	36174951	missense	possibly damaging	0.95
R6468:Uggt1	UTSW	1	36173450	missense	probably benign	0.00
R6788:Uggt1	UTSW	1	36230688	missense	probably benign	0.00
R7165:Uggt1	UTSW	1	36155107	missense	probably benign	0.41
R7255:Uggt1	UTSW	1	36146106	missense	probably damaging	1.00
R7273:Uggt1	UTSW	1	36162221	missense	probably damaging	0.99
R7469:Uggt1	UTSW	1	36151733	missense	probably damaging	1.00
R7490:Uggt1	UTSW	1	36164508	missense	probably benign	0.01
R7570:Uggt1	UTSW	1	36185838	missense	probably benign	0.09
R7612:Uggt1	UTSW	1	36163235	missense	probably damaging	0.99
R7759:Uggt1	UTSW	1	36146725	missense	possibly damaging	0.81
R7792:Uggt1	UTSW	1	36207984	missense	probably damaging	1.00
R7816:Uggt1	UTSW	1	36163315	missense	possibly damaging	0.95
R7858:Uggt1	UTSW	1	36156258	missense	probably damaging	1.00
R7887:Uggt1	UTSW	1	36208034	missense	probably damaging	0.99
R8040:Uggt1	UTSW	1	36211473	missense	possibly damaging	0.70
R8093:Uggt1	UTSW	1	36227485	missense	probably damaging	1.00
R8245:Uggt1	UTSW	1	36165564	missense	probably damaging	1.00
R8338:Uggt1	UTSW	1	36227521	missense	probably damaging	1.00
R8353:Uggt1	UTSW	1	36170296	critical splice acceptor site	probably null
R8442:Uggt1	UTSW	1	36173487	missense	probably damaging	0.99
R8519:Uggt1	UTSW	1	36176643	splice site	probably null
R8529:Uggt1	UTSW	1	36184432	missense	possibly damaging	0.85
R8730:Uggt1	UTSW	1	36197543	critical splice donor site	probably null
R8917:Uggt1	UTSW	1	36146654	missense	not run
X0022:Uggt1	UTSW	1	36165555	missense	possibly damaging	0.67
Z1088:Uggt1	UTSW	1	36174191	missense	probably damaging	1.00
Z1176:Uggt1	UTSW	1	36161695	missense	probably damaging	1.00
Z1177:Uggt1	UTSW	1	36155073	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCAGAATCATCAGCTCACAC -3'
(R):5'- GGGGAAATGTGTGCTCTCTC -3'

Sequencing Primer
(F):5'- CTAAACTAGTGTGCATGAGGCCC -3'
(R):5'- GGAAATGTGTGCTCTCTCTTTTTC -3'

Posted On

2015-03-18