Incidental Mutation 'R3827:Bach2'
ID273796
Institutional Source Beutler Lab
Gene Symbol Bach2
Ensembl Gene ENSMUSG00000040270
Gene NameBTB and CNC homology, basic leucine zipper transcription factor 2
Synonyms
MMRRC Submission 040775-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3827 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location32238804-32586108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32563150 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 539 (L539H)
Ref Sequence ENSEMBL: ENSMUSP00000131592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037416] [ENSMUST00000108180] [ENSMUST00000171600]
Predicted Effect probably benign
Transcript: ENSMUST00000037416
SMART Domains Protein: ENSMUSP00000043693
Gene: ENSMUSG00000040270

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
BRLZ 520 584 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108180
AA Change: L539H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103815
Gene: ENSMUSG00000040270
AA Change: L539H

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149084
Predicted Effect probably damaging
Transcript: ENSMUST00000171600
AA Change: L539H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131592
Gene: ENSMUSG00000040270
AA Change: L539H

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Meta Mutation Damage Score 0.0795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display impaired B cell differentiation and reduced B cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,097 N878S probably benign Het
Cntnap5a G A 1: 116,117,679 D342N probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dpp10 G A 1: 123,411,790 T336I possibly damaging Het
Ehmt2 T C 17: 34,906,765 S625P possibly damaging Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gab2 T A 7: 97,223,741 I117N probably damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gper1 T C 5: 139,427,000 S367P probably benign Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
H2-Q6 A T 17: 35,425,679 N148I probably damaging Het
Kif21b T C 1: 136,162,994 probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr596 T A 7: 103,309,802 I27N probably benign Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Paip1 T A 13: 119,430,232 M1K probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Skint6 G T 4: 112,937,437 L712I probably benign Het
Slc35a4 C A 18: 36,682,988 N290K probably damaging Het
Slco1a5 T A 6: 142,253,249 D230V probably damaging Het
Sox21 C T 14: 118,235,458 E60K possibly damaging Het
Steap3 G A 1: 120,227,730 R500C probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Sulf1 G A 1: 12,817,432 V277I probably benign Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Syne2 A G 12: 75,987,031 R3685G probably benign Het
Tmem203 T A 2: 25,256,006 W113R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Vmn2r102 T A 17: 19,694,525 V784E probably damaging Het
Wrn T C 8: 33,324,520 T56A probably benign Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Other mutations in Bach2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01749:Bach2 APN 4 32580261 missense probably damaging 1.00
IGL02137:Bach2 APN 4 32501621 start gained probably benign
IGL02281:Bach2 APN 4 32562513 missense possibly damaging 0.78
IGL02333:Bach2 APN 4 32575334 nonsense probably null
IGL02369:Bach2 APN 4 32579975 missense possibly damaging 0.85
IGL02533:Bach2 APN 4 32562451 missense probably benign 0.00
Magnificat UTSW 4 32563324 missense probably damaging 1.00
R0011:Bach2 UTSW 4 32244655 intron probably benign
R1240:Bach2 UTSW 4 32563198 missense probably damaging 1.00
R1501:Bach2 UTSW 4 32562279 missense possibly damaging 0.86
R2004:Bach2 UTSW 4 32580055 missense probably benign 0.36
R2171:Bach2 UTSW 4 32501662 missense probably damaging 0.97
R3829:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R3830:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R4564:Bach2 UTSW 4 32563338 missense probably damaging 1.00
R4660:Bach2 UTSW 4 32562777 missense probably benign
R5132:Bach2 UTSW 4 32563396 intron probably benign
R5307:Bach2 UTSW 4 32562683 missense probably benign 0.11
R5491:Bach2 UTSW 4 32562681 missense probably damaging 1.00
R5860:Bach2 UTSW 4 32580268 missense probably damaging 1.00
R5983:Bach2 UTSW 4 32563324 missense probably damaging 1.00
R6331:Bach2 UTSW 4 32238816 start gained probably benign
R6770:Bach2 UTSW 4 32575240 missense possibly damaging 0.81
R6806:Bach2 UTSW 4 32575301 missense possibly damaging 0.66
R7146:Bach2 UTSW 4 32562670 missense probably damaging 1.00
R7691:Bach2 UTSW 4 32580271 missense probably damaging 1.00
R8062:Bach2 UTSW 4 32562937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGACCTTTCGGAGCCG -3'
(R):5'- AGAATGATCCAGACTCGTCACTG -3'

Sequencing Primer
(F):5'- CCGGTGCCAAAAAGTCTATG -3'
(R):5'- CAGACTCGTCACTGGAATTGG -3'
Posted On2015-04-02