Incidental Mutation 'R6806:Bach2'
ID537471
Institutional Source Beutler Lab
Gene Symbol Bach2
Ensembl Gene ENSMUSG00000040270
Gene NameBTB and CNC homology, basic leucine zipper transcription factor 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6806 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location32238804-32586108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32575301 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 509 (M509K)
Ref Sequence ENSEMBL: ENSMUSP00000043693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037416] [ENSMUST00000108180] [ENSMUST00000171600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037416
AA Change: M509K

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043693
Gene: ENSMUSG00000040270
AA Change: M509K

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
BRLZ 520 584 2.3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108180
AA Change: M632K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000103815
Gene: ENSMUSG00000040270
AA Change: M632K

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171600
AA Change: M632K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000131592
Gene: ENSMUSG00000040270
AA Change: M632K

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Meta Mutation Damage Score 0.0680 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (39/41)
MGI Phenotype PHENOTYPE: Homozygous null mice display impaired B cell differentiation and reduced B cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,858 Q520R possibly damaging Het
9130019O22Rik T C 7: 127,386,594 probably benign Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Apba2 T A 7: 64,695,459 D132E probably damaging Het
Atp13a4 A G 16: 29,469,280 S258P probably damaging Het
Ccdc186 T A 19: 56,800,129 K549N probably damaging Het
Chrna3 C T 9: 55,015,810 R238H probably damaging Het
Cntnap5b G A 1: 99,940,649 C30Y probably damaging Het
Dnah11 T C 12: 117,987,676 probably null Het
Ebna1bp2 T C 4: 118,620,977 C16R probably benign Het
Gm884 T C 11: 103,621,124 E6G unknown Het
Grin2b A G 6: 135,774,828 Y579H possibly damaging Het
Ifi206 C T 1: 173,481,571 M286I probably benign Het
Itpr1 G A 6: 108,515,947 V2478I probably benign Het
Ltbp2 T C 12: 84,809,238 S744G possibly damaging Het
Magi3 T A 3: 104,046,969 N684I possibly damaging Het
Muc16 A G 9: 18,537,910 probably null Het
Nphp4 G T 4: 152,538,101 Q614H probably benign Het
Nprl3 A G 11: 32,267,509 I11T probably damaging Het
Olfr635 G T 7: 103,979,564 R124L possibly damaging Het
Pank2 T C 2: 131,262,707 probably benign Het
Prss58 A T 6: 40,897,732 N58K probably damaging Het
Ptk7 C T 17: 46,573,528 V759M probably damaging Het
Rassf7 A G 7: 141,216,809 T28A probably damaging Het
Rbm45 C T 2: 76,380,460 T445I probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc2 T G 5: 123,739,531 probably benign Het
Saxo2 A T 7: 82,635,032 I206N probably benign Het
Sh3d19 T A 3: 86,104,333 Y409N probably damaging Het
Spata31d1a A T 13: 59,703,218 N365K probably benign Het
Stkld1 C G 2: 26,943,910 N136K probably benign Het
Tenm4 A G 7: 96,811,959 D904G possibly damaging Het
Tmf1 G A 6: 97,161,447 R837* probably null Het
Tnn T C 1: 160,120,708 T812A possibly damaging Het
Trgj4 T C 13: 19,342,195 L15P probably damaging Het
Trp53bp1 T C 2: 121,228,666 I905V probably damaging Het
Ubr3 T C 2: 69,955,964 probably benign Het
Zfp446 T C 7: 12,979,116 L27P probably damaging Het
Zfp719 A G 7: 43,586,385 D57G possibly damaging Het
Zfp978 G A 4: 147,390,827 R277K probably benign Het
Other mutations in Bach2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01749:Bach2 APN 4 32580261 missense probably damaging 1.00
IGL02137:Bach2 APN 4 32501621 start gained probably benign
IGL02281:Bach2 APN 4 32562513 missense possibly damaging 0.78
IGL02333:Bach2 APN 4 32575334 nonsense probably null
IGL02369:Bach2 APN 4 32579975 missense possibly damaging 0.85
IGL02533:Bach2 APN 4 32562451 missense probably benign 0.00
Magnificat UTSW 4 32563324 missense probably damaging 1.00
R0011:Bach2 UTSW 4 32244655 intron probably benign
R1240:Bach2 UTSW 4 32563198 missense probably damaging 1.00
R1501:Bach2 UTSW 4 32562279 missense possibly damaging 0.86
R2004:Bach2 UTSW 4 32580055 missense probably benign 0.36
R2171:Bach2 UTSW 4 32501662 missense probably damaging 0.97
R3827:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R3829:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R3830:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R4564:Bach2 UTSW 4 32563338 missense probably damaging 1.00
R4660:Bach2 UTSW 4 32562777 missense probably benign
R5132:Bach2 UTSW 4 32563396 intron probably benign
R5307:Bach2 UTSW 4 32562683 missense probably benign 0.11
R5491:Bach2 UTSW 4 32562681 missense probably damaging 1.00
R5860:Bach2 UTSW 4 32580268 missense probably damaging 1.00
R5983:Bach2 UTSW 4 32563324 missense probably damaging 1.00
R6331:Bach2 UTSW 4 32238816 start gained probably benign
R6770:Bach2 UTSW 4 32575240 missense possibly damaging 0.81
R7146:Bach2 UTSW 4 32562670 missense probably damaging 1.00
R7691:Bach2 UTSW 4 32580271 missense probably damaging 1.00
R8062:Bach2 UTSW 4 32562937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATGACTTGCTCATCTTAAAA -3'
(R):5'- GCTGAGTACCTGCCCACCA -3'

Sequencing Primer
(F):5'- TGCAGAGGACCCAAGTTCAGTTC -3'
(R):5'- AACTCACCAGTTTCCGTATTTCAC -3'
Posted On2018-10-18