Incidental Mutation 'R3829:Bach2'
ID273877
Institutional Source Beutler Lab
Gene Symbol Bach2
Ensembl Gene ENSMUSG00000040270
Gene NameBTB and CNC homology, basic leucine zipper transcription factor 2
Synonyms
MMRRC Submission 040776-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32238804-32586108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32563150 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 539 (L539H)
Ref Sequence ENSEMBL: ENSMUSP00000131592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037416] [ENSMUST00000108180] [ENSMUST00000171600]
Predicted Effect probably benign
Transcript: ENSMUST00000037416
SMART Domains Protein: ENSMUSP00000043693
Gene: ENSMUSG00000040270

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
BRLZ 520 584 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108180
AA Change: L539H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103815
Gene: ENSMUSG00000040270
AA Change: L539H

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149084
Predicted Effect probably damaging
Transcript: ENSMUST00000171600
AA Change: L539H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131592
Gene: ENSMUSG00000040270
AA Change: L539H

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Meta Mutation Damage Score 0.0795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype PHENOTYPE: Homozygous null mice display impaired B cell differentiation and reduced B cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Bach2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01749:Bach2 APN 4 32580261 missense probably damaging 1.00
IGL02137:Bach2 APN 4 32501621 start gained probably benign
IGL02281:Bach2 APN 4 32562513 missense possibly damaging 0.78
IGL02333:Bach2 APN 4 32575334 nonsense probably null
IGL02369:Bach2 APN 4 32579975 missense possibly damaging 0.85
IGL02533:Bach2 APN 4 32562451 missense probably benign 0.00
Magnificat UTSW 4 32563324 missense probably damaging 1.00
R0011:Bach2 UTSW 4 32244655 intron probably benign
R1240:Bach2 UTSW 4 32563198 missense probably damaging 1.00
R1501:Bach2 UTSW 4 32562279 missense possibly damaging 0.86
R2004:Bach2 UTSW 4 32580055 missense probably benign 0.36
R2171:Bach2 UTSW 4 32501662 missense probably damaging 0.97
R3827:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R3830:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R4564:Bach2 UTSW 4 32563338 missense probably damaging 1.00
R4660:Bach2 UTSW 4 32562777 missense probably benign
R5132:Bach2 UTSW 4 32563396 intron probably benign
R5307:Bach2 UTSW 4 32562683 missense probably benign 0.11
R5491:Bach2 UTSW 4 32562681 missense probably damaging 1.00
R5860:Bach2 UTSW 4 32580268 missense probably damaging 1.00
R5983:Bach2 UTSW 4 32563324 missense probably damaging 1.00
R6331:Bach2 UTSW 4 32238816 start gained probably benign
R6770:Bach2 UTSW 4 32575240 missense possibly damaging 0.81
R6806:Bach2 UTSW 4 32575301 missense possibly damaging 0.66
R7146:Bach2 UTSW 4 32562670 missense probably damaging 1.00
R7691:Bach2 UTSW 4 32580271 missense probably damaging 1.00
R8062:Bach2 UTSW 4 32562937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAAGACCTTTCGGAGCCG -3'
(R):5'- AGAATGATCCAGACTCGTCAC -3'

Sequencing Primer
(F):5'- CCGGTGCCAAAAAGTCTATG -3'
(R):5'- CAGACTCGTCACTGGAATTGG -3'
Posted On2015-04-02