Incidental Mutation 'R3877:Mms19'
ID276927
Institutional Source Beutler Lab
Gene Symbol Mms19
Ensembl Gene ENSMUSG00000025159
Gene NameMMS19 (MET18 S. cerevisiae)
SynonymsMms19, 2610042O15Rik, C86341, Mms19l
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location41941086-41981157 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 41966256 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 75 (Q75*)
Ref Sequence ENSEMBL: ENSMUSP00000130900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026168] [ENSMUST00000163287] [ENSMUST00000163398] [ENSMUST00000164776] [ENSMUST00000167927] [ENSMUST00000168484] [ENSMUST00000169775] [ENSMUST00000171561]
Predicted Effect probably null
Transcript: ENSMUST00000026168
AA Change: Q75*
SMART Domains Protein: ENSMUSP00000026168
Gene: ENSMUSG00000025159
AA Change: Q75*

DomainStartEndE-ValueType
Pfam:MMS19_N 51 167 1.4e-29 PFAM
Pfam:MMS19_N 163 270 2.4e-44 PFAM
low complexity region 329 343 N/A INTRINSIC
Pfam:MMS19_C 484 921 4.3e-120 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163287
AA Change: Q27*
SMART Domains Protein: ENSMUSP00000128653
Gene: ENSMUSG00000025159
AA Change: Q27*

DomainStartEndE-ValueType
Pfam:MMS19_N 3 265 9.8e-97 PFAM
Pfam:MMS19_C 381 818 1e-120 PFAM
Predicted Effect silent
Transcript: ENSMUST00000163398
Predicted Effect silent
Transcript: ENSMUST00000164776
Predicted Effect probably null
Transcript: ENSMUST00000167927
AA Change: Q75*
SMART Domains Protein: ENSMUSP00000132483
Gene: ENSMUSG00000025159
AA Change: Q75*

DomainStartEndE-ValueType
Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000168484
AA Change: Q75*
SMART Domains Protein: ENSMUSP00000126881
Gene: ENSMUSG00000025159
AA Change: Q75*

DomainStartEndE-ValueType
Pfam:MMS19_N 51 313 4.6e-99 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169765
AA Change: Q33*
SMART Domains Protein: ENSMUSP00000133075
Gene: ENSMUSG00000025159
AA Change: Q33*

DomainStartEndE-ValueType
Pfam:MMS19_N 10 80 6.3e-12 PFAM
Pfam:MMS19_N 77 129 9.2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169775
AA Change: Q75*
SMART Domains Protein: ENSMUSP00000128234
Gene: ENSMUSG00000025159
AA Change: Q75*

DomainStartEndE-ValueType
Pfam:MMS19_N 51 167 1.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170209
Predicted Effect probably null
Transcript: ENSMUST00000171561
AA Change: Q75*
SMART Domains Protein: ENSMUSP00000130900
Gene: ENSMUSG00000025159
AA Change: Q75*

DomainStartEndE-ValueType
Pfam:MMS19_N 51 312 6.3e-90 PFAM
low complexity region 372 386 N/A INTRINSIC
Pfam:MMS19_C 528 963 3.9e-116 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171755
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Mms19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Mms19 APN 19 41948233 missense probably benign 0.12
IGL00157:Mms19 APN 19 41945457 critical splice donor site probably null
IGL01997:Mms19 APN 19 41956531 missense probably damaging 1.00
IGL02081:Mms19 APN 19 41949979 critical splice donor site probably null
IGL02171:Mms19 APN 19 41957139 critical splice donor site probably null
IGL02306:Mms19 APN 19 41966264 missense probably damaging 1.00
IGL02678:Mms19 APN 19 41954476 missense possibly damaging 0.84
IGL02795:Mms19 APN 19 41952406 critical splice donor site probably null
IGL03233:Mms19 APN 19 41946913 splice site probably null
IGL03250:Mms19 APN 19 41954464 critical splice donor site probably null
R0049:Mms19 UTSW 19 41955168 missense probably damaging 0.99
R0049:Mms19 UTSW 19 41955168 missense probably damaging 0.99
R0480:Mms19 UTSW 19 41954846 missense probably damaging 0.98
R0498:Mms19 UTSW 19 41949773 missense possibly damaging 0.82
R0505:Mms19 UTSW 19 41953734 missense probably damaging 1.00
R0547:Mms19 UTSW 19 41963418 missense probably damaging 0.99
R1102:Mms19 UTSW 19 41950845 missense possibly damaging 0.77
R1183:Mms19 UTSW 19 41954831 missense possibly damaging 0.83
R1544:Mms19 UTSW 19 41955821 critical splice donor site probably null
R1666:Mms19 UTSW 19 41952556 missense possibly damaging 0.73
R1668:Mms19 UTSW 19 41952556 missense possibly damaging 0.73
R1808:Mms19 UTSW 19 41966259 missense probably damaging 1.00
R1827:Mms19 UTSW 19 41953677 missense probably benign 0.00
R3055:Mms19 UTSW 19 41950088 splice site probably benign
R3551:Mms19 UTSW 19 41949798 missense probably benign 0.04
R3716:Mms19 UTSW 19 41944735 missense probably damaging 1.00
R4288:Mms19 UTSW 19 41945553 missense probably damaging 1.00
R4289:Mms19 UTSW 19 41945553 missense probably damaging 1.00
R4445:Mms19 UTSW 19 41963933 missense possibly damaging 0.48
R4446:Mms19 UTSW 19 41963933 missense possibly damaging 0.48
R4610:Mms19 UTSW 19 41945496 missense possibly damaging 0.91
R4734:Mms19 UTSW 19 41944558 missense probably damaging 1.00
R4748:Mms19 UTSW 19 41944558 missense probably damaging 1.00
R5315:Mms19 UTSW 19 41954762 missense possibly damaging 0.68
R5492:Mms19 UTSW 19 41955831 missense possibly damaging 0.91
R5621:Mms19 UTSW 19 41966313 missense probably benign 0.27
R5643:Mms19 UTSW 19 41955866 missense possibly damaging 0.87
R5769:Mms19 UTSW 19 41964386 missense probably damaging 1.00
R6567:Mms19 UTSW 19 41949767 critical splice donor site probably null
R6569:Mms19 UTSW 19 41964368 missense possibly damaging 0.93
R6588:Mms19 UTSW 19 41966276 missense probably damaging 1.00
R6645:Mms19 UTSW 19 41955191 missense probably benign 0.04
R6696:Mms19 UTSW 19 41954013 missense probably benign 0.41
R7050:Mms19 UTSW 19 41950746 splice site probably null
R7426:Mms19 UTSW 19 41948278 missense probably benign
R7564:Mms19 UTSW 19 41947016 missense probably benign 0.09
R7655:Mms19 UTSW 19 41944572 missense probably damaging 0.98
R7656:Mms19 UTSW 19 41944572 missense probably damaging 0.98
R7687:Mms19 UTSW 19 41955168 missense possibly damaging 0.85
R7729:Mms19 UTSW 19 41952465 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCAATAAGGAATGAAGGCCC -3'
(R):5'- TGGACACTAATGTTATTGGCTCAGG -3'

Sequencing Primer
(F):5'- AATGAAGGCCCTTAGTTAGCTG -3'
(R):5'- TCAGGAGCACCTTCATGGG -3'
Posted On2015-04-06