Incidental Mutation 'R3877:Olfr12'
ID276876
Institutional Source Beutler Lab
Gene Symbol Olfr12
Ensembl Gene ENSMUSG00000061616
Gene Nameolfactory receptor 12
SynonymsGA_x6K02T2R7CC-81134096-81133095, MOR208-5
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92617788-92623412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92620083 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 59 (D59V)
Ref Sequence ENSEMBL: ENSMUSP00000150858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081274] [ENSMUST00000213247]
Predicted Effect probably damaging
Transcript: ENSMUST00000081274
AA Change: D59V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080027
Gene: ENSMUSG00000061616
AA Change: D59V

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:7tm_4 38 314 8e-53 PFAM
Pfam:7tm_1 48 297 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213247
AA Change: D59V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Olfr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Olfr12 APN 1 92620199 missense possibly damaging 0.88
IGL01309:Olfr12 APN 1 92620335 missense probably damaging 1.00
IGL02025:Olfr12 APN 1 92620547 missense probably benign 0.00
IGL02517:Olfr12 APN 1 92620461 missense probably benign
IGL02837:Olfr12 UTSW 1 92620682 missense possibly damaging 0.73
R1394:Olfr12 UTSW 1 92620545 missense probably benign 0.02
R1395:Olfr12 UTSW 1 92620545 missense probably benign 0.02
R1590:Olfr12 UTSW 1 92620745 missense possibly damaging 0.64
R1778:Olfr12 UTSW 1 92620620 missense possibly damaging 0.94
R1924:Olfr12 UTSW 1 92620803 missense probably damaging 1.00
R2011:Olfr12 UTSW 1 92620749 missense probably benign 0.01
R5286:Olfr12 UTSW 1 92620362 missense probably benign 0.38
R5513:Olfr12 UTSW 1 92620380 missense probably benign
R5727:Olfr12 UTSW 1 92620178 missense probably benign 0.00
R5905:Olfr12 UTSW 1 92620142 missense possibly damaging 0.49
R5921:Olfr12 UTSW 1 92620622 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCATCTGACCCCACTCATG -3'
(R):5'- TGAAACGATCATAGGCCATCAC -3'

Sequencing Primer
(F):5'- ACTCATGGCCACAGCAGTG -3'
(R):5'- AAGTCTCAGTGGTAGCCAAC -3'
Posted On2015-04-06