Incidental Mutation 'R0369:Zfp91'
ID30409
Institutional Source Beutler Lab
Gene Symbol Zfp91
Ensembl Gene ENSMUSG00000024695
Gene Namezinc finger protein 91
SynonymsPzf, 9130014I08Rik, A530054C17Rik
MMRRC Submission 038575-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.382) question?
Stock #R0369 (G1)
Quality Score204
Status Not validated
Chromosome19
Chromosomal Location12763660-12796126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12770074 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 562 (V562I)
Ref Sequence ENSEMBL: ENSMUSP00000037971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038627] [ENSMUST00000112933] [ENSMUST00000142247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038627
AA Change: V562I

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037971
Gene: ENSMUSG00000024695
AA Change: V562I

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 43 N/A INTRINSIC
low complexity region 72 92 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
low complexity region 207 226 N/A INTRINSIC
coiled coil region 256 284 N/A INTRINSIC
ZnF_C2H2 313 338 1.08e-1 SMART
ZnF_C2H2 344 368 7.15e-2 SMART
ZnF_C2H2 374 396 1.56e-2 SMART
ZnF_C2H2 402 424 2.61e-4 SMART
ZnF_C2H2 432 455 1.92e-2 SMART
low complexity region 459 471 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112933
SMART Domains Protein: ENSMUSP00000108555
Gene: ENSMUSG00000079415

DomainStartEndE-ValueType
Pfam:CNTF 1 194 4.2e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137256
Predicted Effect probably benign
Transcript: ENSMUST00000142247
SMART Domains Protein: ENSMUSP00000124424
Gene: ENSMUSG00000024695

DomainStartEndE-ValueType
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 43 N/A INTRINSIC
low complexity region 72 92 N/A INTRINSIC
low complexity region 98 114 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 143 167 N/A INTRINSIC
low complexity region 207 226 N/A INTRINSIC
coiled coil region 256 284 N/A INTRINSIC
ZnF_C2H2 313 338 1.08e-1 SMART
ZnF_C2H2 344 368 7.15e-2 SMART
ZnF_C2H2 374 396 1.56e-2 SMART
ZnF_C2H2 402 424 2.61e-4 SMART
ZnF_C2H2 432 455 1.92e-2 SMART
low complexity region 459 471 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the zinc finger family of proteins. The gene product contains C2H2-type domains, which are the classical zinc finger domains found in numerous nucleic acid-binding proteins. The homologous human protein has been shown to function as a regulator of the non-canonical NF-kappaB pathway in lymphotoxin-beta receptor signaling. A read-through transcript variant composed of Zfp91 and the downstream Cntf gene sequence has been identified, but it is thought to be non-coding. Read-through transcription of Zfp91 and Cntf has been observed in both human and mouse. A Zfp91-related pseudogene has also been identified on chromosome 17. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik G A 9: 114,300,009 noncoding transcript Het
Aadacl2 T A 3: 60,024,722 Y219* probably null Het
Adamts13 C A 2: 27,005,186 D1096E probably benign Het
Adamts16 T G 13: 70,779,552 K523Q possibly damaging Het
Adcy2 A G 13: 68,671,900 F740S probably benign Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Ccdc97 T C 7: 25,714,408 T283A probably damaging Het
Cmpk2 G T 12: 26,477,151 E380* probably null Het
Csmd3 A G 15: 47,970,147 I911T probably damaging Het
Cyp2c39 T C 19: 39,513,635 L156P probably damaging Het
D7Ertd443e T C 7: 134,298,137 I499V possibly damaging Het
Dhx58 A C 11: 100,701,548 probably null Het
Dip2a C T 10: 76,298,787 G390S probably damaging Het
Dusp10 A G 1: 184,069,056 D340G probably damaging Het
Epha1 A T 6: 42,365,473 C314S probably damaging Het
Exph5 A T 9: 53,373,302 H561L probably benign Het
Fbxw26 A G 9: 109,723,712 probably null Het
Foxc1 A C 13: 31,807,512 N102T probably damaging Het
Fsip2 T C 2: 82,984,564 I3547T probably benign Het
Gm5464 G T 14: 66,869,325 probably benign Het
Gnptab C T 10: 88,433,594 R720C possibly damaging Het
Greb1l T C 18: 10,469,375 V130A possibly damaging Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Hnrnpul2 C A 19: 8,824,413 D328E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift172 T C 5: 31,253,641 Y1691C probably damaging Het
Kremen2 T C 17: 23,742,810 D241G probably benign Het
Meis2 T C 2: 116,063,416 D5G possibly damaging Het
Mrps5 G A 2: 127,591,829 R46K probably benign Het
Myh14 C T 7: 44,660,950 V170M probably damaging Het
Nexn T C 3: 152,248,257 N123D probably benign Het
Olfr1423 A T 19: 12,036,401 S114T probably benign Het
Olfr606 T A 7: 103,452,216 I293N probably damaging Het
Olfr742 T A 14: 50,515,825 M207K probably benign Het
Pacs1 C T 19: 5,141,698 V704M probably damaging Het
Papolg A G 11: 23,872,425 probably null Het
Pdlim3 T C 8: 45,917,506 V281A probably benign Het
Plpp4 T G 7: 129,323,466 F142V probably damaging Het
Prb1 G A 6: 132,207,657 Q338* probably null Het
Psg26 G T 7: 18,482,556 Y119* probably null Het
Ptger4 A G 15: 5,243,010 C68R probably benign Het
Ptpre T A 7: 135,670,715 I399N probably damaging Het
Ripply2 A G 9: 87,016,319 Y72C probably damaging Het
Rp1l1 T A 14: 64,029,388 S808T possibly damaging Het
Scn5a G A 9: 119,533,772 T594I probably damaging Het
Sf3b1 T C 1: 54,998,108 D883G probably benign Het
Skint5 A T 4: 113,512,023 probably null Het
Terf1 A G 1: 15,818,983 H212R probably damaging Het
Tmco5 T G 2: 116,880,788 probably null Het
Tnfaip3 A T 10: 19,006,912 Y252* probably null Het
Tnrc6a T A 7: 123,170,860 N624K probably damaging Het
Top3a C A 11: 60,742,789 R827L probably damaging Het
Unc79 G A 12: 103,088,772 probably null Het
Usp20 T C 2: 31,011,104 S422P probably benign Het
Utrn T C 10: 12,634,022 E2402G probably benign Het
Wdr3 G A 3: 100,156,418 Q181* probably null Het
Zfp536 T C 7: 37,567,948 E681G probably damaging Het
Zfp942 A T 17: 21,929,036 I204N probably benign Het
Other mutations in Zfp91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02240:Zfp91 APN 19 12776406 splice site probably benign
R0139:Zfp91 UTSW 19 12770470 missense probably damaging 1.00
R0485:Zfp91 UTSW 19 12775989 splice site probably benign
R0559:Zfp91 UTSW 19 12770055 missense probably damaging 1.00
R0597:Zfp91 UTSW 19 12770095 missense possibly damaging 0.53
R1565:Zfp91 UTSW 19 12779075 missense probably benign 0.02
R3422:Zfp91 UTSW 19 12770292 missense probably benign 0.24
R4438:Zfp91 UTSW 19 12778021 nonsense probably null
R4898:Zfp91 UTSW 19 12770060 missense probably damaging 1.00
R4927:Zfp91 UTSW 19 12776410 critical splice donor site probably null
R5509:Zfp91 UTSW 19 12779087 missense probably damaging 0.99
R5878:Zfp91 UTSW 19 12770320 missense possibly damaging 0.80
R5978:Zfp91 UTSW 19 12770151 missense probably benign 0.43
R7703:Zfp91 UTSW 19 12776877 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TGATCCACAATGCAAAGAGCAGGC -3'
(R):5'- ACCCTGAGGTGCTGATTGCAGAAG -3'

Sequencing Primer
(F):5'- TGCAAAGAGCAGGCCCTTC -3'
(R):5'- GATATCTTGGGCACTAACCCAGAG -3'
Posted On2013-04-24