Incidental Mutation 'R0369:Adcy2'
ID30395
Institutional Source Beutler Lab
Gene Symbol Adcy2
Ensembl Gene ENSMUSG00000021536
Gene Nameadenylate cyclase 2
Synonyms
MMRRC Submission 038575-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0369 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location68620043-68999541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68671900 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 740 (F740S)
Ref Sequence ENSEMBL: ENSMUSP00000022013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022013]
Predicted Effect probably benign
Transcript: ENSMUST00000022013
AA Change: F740S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000022013
Gene: ENSMUSG00000021536
AA Change: F740S

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
CYCc 239 447 6.62e-66 SMART
Pfam:DUF1053 499 604 2.6e-41 PFAM
transmembrane domain 631 653 N/A INTRINSIC
low complexity region 659 673 N/A INTRINSIC
transmembrane domain 684 706 N/A INTRINSIC
transmembrane domain 738 760 N/A INTRINSIC
transmembrane domain 767 789 N/A INTRINSIC
transmembrane domain 809 826 N/A INTRINSIC
CYCc 851 1065 5.49e-40 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This enzyme is insensitive to Ca(2+)/calmodulin, and is stimulated by the G protein beta and gamma subunit complex. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik G A 9: 114,300,009 noncoding transcript Het
Aadacl2 T A 3: 60,024,722 Y219* probably null Het
Adamts13 C A 2: 27,005,186 D1096E probably benign Het
Adamts16 T G 13: 70,779,552 K523Q possibly damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Ccdc97 T C 7: 25,714,408 T283A probably damaging Het
Cmpk2 G T 12: 26,477,151 E380* probably null Het
Csmd3 A G 15: 47,970,147 I911T probably damaging Het
Cyp2c39 T C 19: 39,513,635 L156P probably damaging Het
D7Ertd443e T C 7: 134,298,137 I499V possibly damaging Het
Dhx58 A C 11: 100,701,548 probably null Het
Dip2a C T 10: 76,298,787 G390S probably damaging Het
Dusp10 A G 1: 184,069,056 D340G probably damaging Het
Epha1 A T 6: 42,365,473 C314S probably damaging Het
Exph5 A T 9: 53,373,302 H561L probably benign Het
Fbxw26 A G 9: 109,723,712 probably null Het
Foxc1 A C 13: 31,807,512 N102T probably damaging Het
Fsip2 T C 2: 82,984,564 I3547T probably benign Het
Gm5464 G T 14: 66,869,325 probably benign Het
Gnptab C T 10: 88,433,594 R720C possibly damaging Het
Greb1l T C 18: 10,469,375 V130A possibly damaging Het
Hmg20a A T 9: 56,487,650 D216V probably damaging Het
Hnrnpul2 C A 19: 8,824,413 D328E probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ift172 T C 5: 31,253,641 Y1691C probably damaging Het
Kremen2 T C 17: 23,742,810 D241G probably benign Het
Meis2 T C 2: 116,063,416 D5G possibly damaging Het
Mrps5 G A 2: 127,591,829 R46K probably benign Het
Myh14 C T 7: 44,660,950 V170M probably damaging Het
Nexn T C 3: 152,248,257 N123D probably benign Het
Olfr1423 A T 19: 12,036,401 S114T probably benign Het
Olfr606 T A 7: 103,452,216 I293N probably damaging Het
Olfr742 T A 14: 50,515,825 M207K probably benign Het
Pacs1 C T 19: 5,141,698 V704M probably damaging Het
Papolg A G 11: 23,872,425 probably null Het
Pdlim3 T C 8: 45,917,506 V281A probably benign Het
Plpp4 T G 7: 129,323,466 F142V probably damaging Het
Prb1 G A 6: 132,207,657 Q338* probably null Het
Psg26 G T 7: 18,482,556 Y119* probably null Het
Ptger4 A G 15: 5,243,010 C68R probably benign Het
Ptpre T A 7: 135,670,715 I399N probably damaging Het
Ripply2 A G 9: 87,016,319 Y72C probably damaging Het
Rp1l1 T A 14: 64,029,388 S808T possibly damaging Het
Scn5a G A 9: 119,533,772 T594I probably damaging Het
Sf3b1 T C 1: 54,998,108 D883G probably benign Het
Skint5 A T 4: 113,512,023 probably null Het
Terf1 A G 1: 15,818,983 H212R probably damaging Het
Tmco5 T G 2: 116,880,788 probably null Het
Tnfaip3 A T 10: 19,006,912 Y252* probably null Het
Tnrc6a T A 7: 123,170,860 N624K probably damaging Het
Top3a C A 11: 60,742,789 R827L probably damaging Het
Unc79 G A 12: 103,088,772 probably null Het
Usp20 T C 2: 31,011,104 S422P probably benign Het
Utrn T C 10: 12,634,022 E2402G probably benign Het
Wdr3 G A 3: 100,156,418 Q181* probably null Het
Zfp536 T C 7: 37,567,948 E681G probably damaging Het
Zfp91 C T 19: 12,770,074 V562I possibly damaging Het
Zfp942 A T 17: 21,929,036 I204N probably benign Het
Other mutations in Adcy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Adcy2 APN 13 68620796 missense probably damaging 1.00
IGL01074:Adcy2 APN 13 68796654 missense possibly damaging 0.93
IGL01394:Adcy2 APN 13 68982402 missense probably damaging 1.00
IGL01820:Adcy2 APN 13 68738545 splice site probably null
IGL02048:Adcy2 APN 13 68888067 missense possibly damaging 0.46
IGL02378:Adcy2 APN 13 68730292 missense probably damaging 1.00
IGL02419:Adcy2 APN 13 68982363 missense probably benign 0.40
IGL02896:Adcy2 APN 13 68727872 missense probably damaging 1.00
IGL02953:Adcy2 APN 13 68729328 missense probably damaging 1.00
IGL03358:Adcy2 APN 13 68729277 missense probably damaging 1.00
IGL03387:Adcy2 APN 13 68730367 missense probably damaging 1.00
PIT4305001:Adcy2 UTSW 13 68678602 missense probably benign 0.00
PIT4366001:Adcy2 UTSW 13 68709990 critical splice donor site probably benign
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0044:Adcy2 UTSW 13 68727899 missense possibly damaging 0.94
R0083:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0108:Adcy2 UTSW 13 68651935 missense probably damaging 0.99
R0269:Adcy2 UTSW 13 68678606 nonsense probably null
R0480:Adcy2 UTSW 13 68732112 missense probably damaging 1.00
R0550:Adcy2 UTSW 13 68982361 missense probably benign 0.23
R0551:Adcy2 UTSW 13 68796539 missense probably damaging 1.00
R0617:Adcy2 UTSW 13 68678606 nonsense probably null
R0634:Adcy2 UTSW 13 68727945 missense possibly damaging 0.48
R0715:Adcy2 UTSW 13 68888042 missense probably benign 0.08
R0723:Adcy2 UTSW 13 68999129 missense probably damaging 1.00
R1136:Adcy2 UTSW 13 68730317 missense probably damaging 1.00
R1271:Adcy2 UTSW 13 68642498 missense probably damaging 1.00
R1349:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1372:Adcy2 UTSW 13 68668533 missense probably damaging 0.98
R1390:Adcy2 UTSW 13 68657393 missense possibly damaging 0.94
R1495:Adcy2 UTSW 13 68796535 missense probably benign 0.30
R1706:Adcy2 UTSW 13 68720746 missense probably damaging 1.00
R1839:Adcy2 UTSW 13 68689261 splice site probably null
R2004:Adcy2 UTSW 13 68796603 missense probably damaging 1.00
R2235:Adcy2 UTSW 13 68668492 missense probably damaging 0.98
R2242:Adcy2 UTSW 13 68689341 missense probably benign 0.00
R2940:Adcy2 UTSW 13 68730305 missense probably damaging 1.00
R3624:Adcy2 UTSW 13 68642531 missense probably damaging 0.99
R3689:Adcy2 UTSW 13 68630969 missense probably damaging 1.00
R4685:Adcy2 UTSW 13 68727905 missense probably benign 0.32
R4695:Adcy2 UTSW 13 68727843 missense possibly damaging 0.67
R5213:Adcy2 UTSW 13 68620823 missense possibly damaging 0.61
R5645:Adcy2 UTSW 13 68729202 splice site probably null
R5687:Adcy2 UTSW 13 68620819 nonsense probably null
R5687:Adcy2 UTSW 13 68642569 missense probably damaging 1.00
R5833:Adcy2 UTSW 13 68738603 missense probably benign
R5846:Adcy2 UTSW 13 68738588 missense probably damaging 0.99
R5894:Adcy2 UTSW 13 68625852 missense probably damaging 1.00
R6111:Adcy2 UTSW 13 68729241 missense probably damaging 0.99
R6311:Adcy2 UTSW 13 68625792 missense probably damaging 1.00
R6642:Adcy2 UTSW 13 68620826 missense probably damaging 1.00
R6644:Adcy2 UTSW 13 68668552 missense possibly damaging 0.88
R6899:Adcy2 UTSW 13 68982381 missense probably damaging 0.99
R6917:Adcy2 UTSW 13 68620757 missense possibly damaging 0.68
R6950:Adcy2 UTSW 13 68888065 missense possibly damaging 0.93
R7006:Adcy2 UTSW 13 68888020 missense probably damaging 1.00
R7186:Adcy2 UTSW 13 68668639 missense probably damaging 1.00
R7311:Adcy2 UTSW 13 68630954 missense probably damaging 1.00
R7348:Adcy2 UTSW 13 68734675 missense possibly damaging 0.79
R7440:Adcy2 UTSW 13 68796667 missense probably damaging 0.97
R7463:Adcy2 UTSW 13 68730280 missense probably damaging 1.00
R7827:Adcy2 UTSW 13 68689281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGAAACCGTGATACTTTCCAG -3'
(R):5'- CCAGGACTGTTCACTGACTGTACAC -3'

Sequencing Primer
(F):5'- GAAACCGTGATACTTTCCAGATCTTC -3'
(R):5'- CTGTTCACTGACTGTACACAAGAAG -3'
Posted On2013-04-24