Incidental Mutation 'R3925:Pycr1'
ID308250
Institutional Source Beutler Lab
Gene Symbol Pycr1
Ensembl Gene ENSMUSG00000025140
Gene Namepyrroline-5-carboxylate reductase 1
Synonyms
MMRRC Submission 040916-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3925 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location120635712-120643769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120642135 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 100 (T100A)
Ref Sequence ENSEMBL: ENSMUSP00000117737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026133] [ENSMUST00000026134] [ENSMUST00000139706] [ENSMUST00000141254] [ENSMUST00000151876] [ENSMUST00000170556]
Predicted Effect probably benign
Transcript: ENSMUST00000026133
AA Change: T100A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000026133
Gene: ENSMUSG00000025140
AA Change: T100A

DomainStartEndE-ValueType
Pfam:F420_oxidored 2 98 5e-23 PFAM
Pfam:NAD_Gly3P_dh_N 2 144 9e-9 PFAM
Pfam:P5CR_dimer 162 268 2e-42 PFAM
low complexity region 292 303 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026134
SMART Domains Protein: ENSMUSP00000026134
Gene: ENSMUSG00000025141

DomainStartEndE-ValueType
Pfam:MARVEL 17 149 3.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133908
Predicted Effect probably benign
Transcript: ENSMUST00000139706
AA Change: T100A

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117737
Gene: ENSMUSG00000025140
AA Change: T100A

DomainStartEndE-ValueType
Pfam:F420_oxidored 2 98 8.9e-25 PFAM
Pfam:NAD_Gly3P_dh_N 2 145 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141254
AA Change: T100A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114863
Gene: ENSMUSG00000025140
AA Change: T100A

DomainStartEndE-ValueType
Pfam:F420_oxidored 2 98 2.5e-24 PFAM
Pfam:NAD_Gly3P_dh_N 2 145 3.5e-9 PFAM
Pfam:P5CR_dimer 162 238 6.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145047
Predicted Effect probably benign
Transcript: ENSMUST00000151876
AA Change: T70A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000120558
Gene: ENSMUSG00000025140
AA Change: T70A

DomainStartEndE-ValueType
Pfam:F420_oxidored 1 68 5.7e-13 PFAM
Pfam:NAD_Gly3P_dh_N 13 119 3e-8 PFAM
Pfam:P5CR_dimer 132 164 2.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170556
AA Change: T100A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000131199
Gene: ENSMUSG00000025140
AA Change: T100A

DomainStartEndE-ValueType
Pfam:F420_oxidored 2 98 8.4e-24 PFAM
Pfam:P5CR_dimer 163 267 2.3e-40 PFAM
low complexity region 292 303 N/A INTRINSIC
Meta Mutation Damage Score 0.4257 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the NAD(P)H-dependent conversion of pyrroline-5-carboxylate to proline. This enzyme may also play a physiologic role in the generation of NADP(+) in some cell types. The protein forms a homopolymer and localizes to the mitochondrion. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,578,772 T487I possibly damaging Het
Amn T C 12: 111,275,680 V367A possibly damaging Het
C230029F24Rik AGAAAG A 1: 49,310,929 noncoding transcript Het
Cdkl1 G T 12: 69,756,599 R168S probably damaging Het
Cfap43 T C 19: 47,797,116 K445R probably benign Het
Crct1 C A 3: 93,014,707 probably benign Het
Eif4e G A 3: 138,555,437 G164D probably damaging Het
Eno1 T C 4: 150,239,568 probably null Het
Gm38100 T C 1: 175,921,286 V306A probably benign Het
Hmcn2 G A 2: 31,453,157 R4565Q probably benign Het
Itgal A T 7: 127,324,537 probably benign Het
Klhl1 A T 14: 96,346,880 C305S possibly damaging Het
Ms4a2 A G 19: 11,618,948 M139T probably benign Het
Nr2e3 C T 9: 59,948,433 R213H probably damaging Het
Olfr1102 A G 2: 87,002,374 Y135C possibly damaging Het
Olfr224 T A 11: 58,566,826 H173L probably benign Het
Olfr664 T A 7: 104,734,189 E58D probably benign Het
Onecut2 A G 18: 64,341,520 K381E probably damaging Het
Pabpc1l T A 2: 164,027,676 probably benign Het
Prim2 A G 1: 33,533,299 L253P probably damaging Het
Qrfpr T C 3: 36,221,923 N106S possibly damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenoi T A 5: 30,256,088 D107E probably damaging Het
Synrg C T 11: 84,040,899 P1321S probably benign Het
Tcrg-V7 A G 13: 19,178,474 Y111C probably damaging Het
Trp53rkb A G 2: 166,795,472 Y116C probably damaging Het
Usp34 T A 11: 23,343,640 F245I probably benign Het
Utrn C T 10: 12,698,042 V1095I probably benign Het
Xpnpep1 T C 19: 52,991,697 H632R probably damaging Het
Zfp735 T C 11: 73,711,124 I298T probably benign Het
Zfp953 T A 13: 67,347,938 Y13F probably damaging Het
Other mutations in Pycr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Pycr1 APN 11 120641266 missense probably benign 0.00
R0285:Pycr1 UTSW 11 120640316 missense probably benign 0.01
R0400:Pycr1 UTSW 11 120641526 splice site probably benign
R2047:Pycr1 UTSW 11 120641686 missense possibly damaging 0.89
R3548:Pycr1 UTSW 11 120642246 missense probably benign 0.22
R3926:Pycr1 UTSW 11 120642135 missense probably benign 0.09
R4166:Pycr1 UTSW 11 120642123 missense probably benign 0.00
R5261:Pycr1 UTSW 11 120641224 missense probably damaging 1.00
R5906:Pycr1 UTSW 11 120642162 missense probably damaging 0.98
R7426:Pycr1 UTSW 11 120642923 missense probably benign 0.02
R7985:Pycr1 UTSW 11 120642920 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGATGTGCTTCCCCTATGG -3'
(R):5'- TCAGCTTTGTGGGCAGATAG -3'

Sequencing Primer
(F):5'- ATGGAGCACTTCCTGAGTTC -3'
(R):5'- AAGCTGGGTCTCCTTGCAC -3'
Posted On2015-04-17