Incidental Mutation 'R3901:Csrnp1'
ID308985
Institutional Source Beutler Lab
Gene Symbol Csrnp1
Ensembl Gene ENSMUSG00000032515
Gene Namecysteine-serine-rich nuclear protein 1
Synonyms4931429D10Rik, taip-3, CSRNP-1, Axud1
MMRRC Submission 040810-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3901 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119971163-119984658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119972641 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 451 (E451K)
Ref Sequence ENSEMBL: ENSMUSP00000149214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035100] [ENSMUST00000035101] [ENSMUST00000177637] [ENSMUST00000213936] [ENSMUST00000214058] [ENSMUST00000215916] [ENSMUST00000216929]
Predicted Effect probably benign
Transcript: ENSMUST00000035100
SMART Domains Protein: ENSMUSP00000035100
Gene: ENSMUSG00000032514

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
Blast:TPR 214 247 6e-11 BLAST
TPR 326 359 4.55e1 SMART
TPR 494 527 1.97e1 SMART
Blast:TPR 528 561 1e-14 BLAST
TPR 565 598 2.63e1 SMART
Blast:TPR 617 649 6e-11 BLAST
TPR 721 754 1.33e0 SMART
TPR 755 788 4.84e-3 SMART
TPR 790 821 1.14e1 SMART
TPR 883 916 9.03e-3 SMART
low complexity region 921 935 N/A INTRINSIC
TPR 951 984 1.08e1 SMART
Blast:TPR 1022 1054 3e-12 BLAST
low complexity region 1117 1129 N/A INTRINSIC
TPR 1195 1228 2.22e-2 SMART
TPR 1264 1297 9.73e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000035101
AA Change: E451K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035101
Gene: ENSMUSG00000032515
AA Change: E451K

DomainStartEndE-ValueType
low complexity region 17 41 N/A INTRINSIC
Pfam:CSRNP_N 79 304 1.6e-93 PFAM
low complexity region 327 361 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 463 482 N/A INTRINSIC
low complexity region 487 499 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213936
Predicted Effect probably damaging
Transcript: ENSMUST00000214058
AA Change: E451K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215916
AA Change: E451K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000216929
Meta Mutation Damage Score 0.3872 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the nucleus and expression of this gene is induced in response to elevated levels of axin. The Wnt signalling pathway, which is negatively regulated by axin, is important in axis formation in early development and impaired regulation of this signalling pathway is often involved in tumors. A decreased level of expression of this gene in tumors compared to the level of expression in their corresponding normal tissues suggests that this gene product has a tumor suppressor function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality and skeletal and craniofacial defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik AC A 17: 47,433,423 probably benign Het
Adamts20 T A 15: 94,328,845 D1109V possibly damaging Het
Apc2 G C 10: 80,315,088 R1992P possibly damaging Het
Atmin A G 8: 116,956,297 N232S probably benign Het
Brat1 A C 5: 140,717,996 D668A possibly damaging Het
Casp16-ps A T 17: 23,552,948 V101E probably damaging Het
Cass4 C T 2: 172,432,558 P753L probably damaging Het
Clec7a A G 6: 129,468,914 S98P possibly damaging Het
Cpne5 G A 17: 29,159,108 R566C unknown Het
Dlst A G 12: 85,132,691 T435A possibly damaging Het
Dock8 A G 19: 25,100,905 T525A possibly damaging Het
Dync2li1 A G 17: 84,631,642 T45A probably damaging Het
Efcab3 A G 11: 105,083,887 N5307S possibly damaging Het
Epha4 A G 1: 77,380,902 Y820H probably damaging Het
F5 A G 1: 164,176,229 T198A probably benign Het
Fbn2 T A 18: 58,066,011 N1395I probably damaging Het
Fcnb T A 2: 28,079,196 Y163F probably damaging Het
Gm5444 T C 13: 4,834,279 noncoding transcript Het
Jph3 G T 8: 121,753,419 D279Y possibly damaging Het
Kcnj3 A G 2: 55,437,348 N50D possibly damaging Het
Kcnma1 A G 14: 23,505,255 I416T probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2e A G 5: 23,501,642 N1401S probably benign Het
Lama5 C T 2: 180,182,351 probably benign Het
Lrp1b A G 2: 40,822,695 V3095A probably damaging Het
Mmp1a A G 9: 7,475,345 *372W probably null Het
Olfr867 C T 9: 20,054,873 V197I probably benign Het
Pdgfra T A 5: 75,192,508 N986K probably benign Het
Pgap1 C T 1: 54,493,348 V671I probably benign Het
Pla2g4e T C 2: 120,168,604 S760G probably benign Het
Plk3 T C 4: 117,133,436 I94V probably benign Het
Pogk C T 1: 166,403,624 V45I probably damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Rims1 T A 1: 22,533,497 Q541L probably benign Het
Rptn A G 3: 93,398,357 Q999R probably benign Het
Stxbp5 A G 10: 9,769,419 L911P probably damaging Het
Tgfbr3 A G 5: 107,214,887 probably benign Het
Trim7 A T 11: 48,837,608 T28S probably damaging Het
Zfp595 T C 13: 67,317,315 I295V probably benign Het
Other mutations in Csrnp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Csrnp1 APN 9 119972958 missense probably damaging 1.00
IGL02348:Csrnp1 APN 9 119972643 missense probably damaging 1.00
R0463:Csrnp1 UTSW 9 119972775 unclassified probably benign
R1530:Csrnp1 UTSW 9 119973546 missense possibly damaging 0.69
R5851:Csrnp1 UTSW 9 119973078 missense possibly damaging 0.93
R6101:Csrnp1 UTSW 9 119973485 missense probably damaging 0.97
R7621:Csrnp1 UTSW 9 119977092 missense probably benign 0.12
R7658:Csrnp1 UTSW 9 119972403 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTCGGGAAGTATAGTGAGGTC -3'
(R):5'- GGAACAGATCCTGAATTTCAGTG -3'

Sequencing Primer
(F):5'- GTGAGGTCCCAGACTATAATCTG -3'
(R):5'- CAGTGACTCTGACCTCGGAATTGAG -3'
Posted On2015-04-17