Incidental Mutation 'R3915:Smco1'
ID309616
Institutional Source Beutler Lab
Gene Symbol Smco1
Ensembl Gene ENSMUSG00000046345
Gene Namesingle-pass membrane protein with coiled-coil domains 1
Synonyms2310010M20Rik
MMRRC Submission 040913-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R3915 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32271468-32274781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32273765 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 85 (I85V)
Ref Sequence ENSEMBL: ENSMUSP00000090873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014218] [ENSMUST00000093183] [ENSMUST00000155649] [ENSMUST00000171474]
Predicted Effect probably benign
Transcript: ENSMUST00000014218
SMART Domains Protein: ENSMUSP00000014218
Gene: ENSMUSG00000014074

DomainStartEndE-ValueType
RING 16 54 8.23e-6 SMART
coiled coil region 114 184 N/A INTRINSIC
low complexity region 208 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093183
AA Change: I85V

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000090873
Gene: ENSMUSG00000046345
AA Change: I85V

DomainStartEndE-ValueType
Pfam:DUF4547 19 214 5e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155649
SMART Domains Protein: ENSMUSP00000115807
Gene: ENSMUSG00000014074

DomainStartEndE-ValueType
RING 16 54 8.23e-6 SMART
coiled coil region 114 183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171474
SMART Domains Protein: ENSMUSP00000126484
Gene: ENSMUSG00000014074

DomainStartEndE-ValueType
RING 18 56 8.23e-6 SMART
coiled coil region 116 186 N/A INTRINSIC
low complexity region 210 223 N/A INTRINSIC
Meta Mutation Damage Score 0.0742 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik G A 5: 3,577,248 V75I possibly damaging Het
AA986860 A G 1: 130,742,607 K189E probably benign Het
Abcf1 C T 17: 35,959,510 R596H possibly damaging Het
Axl T C 7: 25,760,744 probably benign Het
Birc6 A G 17: 74,579,608 K644E probably benign Het
Btbd11 C A 10: 85,632,270 H810N probably damaging Het
Btnl7-ps T A 17: 34,541,515 noncoding transcript Het
Car8 A T 4: 8,184,576 probably benign Het
Ccdc62 C T 5: 123,954,715 R588C probably damaging Het
Clasp2 T G 9: 113,908,737 S374A probably damaging Het
Ctnnb1 A G 9: 120,955,651 H503R probably benign Het
Cwf19l2 A G 9: 3,456,776 H703R probably damaging Het
Efcab7 A T 4: 99,878,173 Q133L probably damaging Het
Ehmt2 T C 17: 34,903,467 S280P probably damaging Het
Eomes A G 9: 118,481,273 M351V probably benign Het
Ets2 G A 16: 95,718,993 R421H probably damaging Het
Fam222b C G 11: 78,154,930 P439R probably benign Het
Gbp11 T A 5: 105,331,112 K153N probably damaging Het
Gm8989 A G 7: 106,330,238 S151P probably benign Het
Gm8994 A T 6: 136,329,422 T294S probably benign Het
Golim4 T C 3: 75,903,327 T174A probably damaging Het
Grid1 A G 14: 35,520,727 Y679C probably damaging Het
Ikzf3 T C 11: 98,490,586 D56G probably damaging Het
Kcnj16 A G 11: 111,025,556 D348G probably benign Het
Kidins220 T C 12: 25,053,958 L1319P possibly damaging Het
Lrp1b T A 2: 41,449,236 D751V probably damaging Het
Macc1 T C 12: 119,446,816 C440R probably benign Het
Mbd2 T C 18: 70,622,609 V382A probably benign Het
Olfr45 T A 7: 140,690,975 D23E probably benign Het
Olfr559 C T 7: 102,724,202 R96H possibly damaging Het
Olfr780 G A 10: 129,322,309 A229T probably benign Het
Pgs1 T G 11: 118,019,646 S528A probably benign Het
Pitpnm3 T C 11: 72,112,284 T67A probably damaging Het
Pnliprp2 T G 19: 58,760,362 V33G probably damaging Het
Ptn T C 6: 36,743,347 N90S probably damaging Het
Ptprt A T 2: 161,555,555 probably benign Het
Ranbp17 G A 11: 33,479,189 A352V probably benign Het
Rasgrp1 G A 2: 117,288,641 S505F probably damaging Het
Sesn1 G A 10: 41,894,890 R139H probably benign Het
Slc17a7 T A 7: 45,168,720 L23Q probably damaging Het
Slc30a10 G T 1: 185,455,136 E25* probably null Het
Vmn1r76 A T 7: 11,930,569 S239R probably benign Het
Zc3h7a A T 16: 11,156,210 V237D possibly damaging Het
Other mutations in Smco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Smco1 APN 16 32274069 missense probably damaging 1.00
IGL01704:Smco1 APN 16 32273886 missense probably benign 0.26
IGL02000:Smco1 APN 16 32273933 missense possibly damaging 0.75
R0217:Smco1 UTSW 16 32273781 missense possibly damaging 0.77
R0602:Smco1 UTSW 16 32273244 missense probably damaging 0.98
R1794:Smco1 UTSW 16 32274132 missense probably benign 0.03
R1913:Smco1 UTSW 16 32273882 missense probably damaging 1.00
R1996:Smco1 UTSW 16 32273912 missense probably benign 0.00
R1998:Smco1 UTSW 16 32273840 missense probably damaging 1.00
R3801:Smco1 UTSW 16 32273898 missense probably benign 0.00
R3802:Smco1 UTSW 16 32273898 missense probably benign 0.00
R5194:Smco1 UTSW 16 32273774 missense probably damaging 1.00
R5464:Smco1 UTSW 16 32273876 missense probably damaging 1.00
R5850:Smco1 UTSW 16 32273856 missense probably damaging 1.00
R6221:Smco1 UTSW 16 32273205 missense probably benign 0.00
R6267:Smco1 UTSW 16 32274014 missense probably benign 0.00
R6454:Smco1 UTSW 16 32273223 missense possibly damaging 0.46
R7068:Smco1 UTSW 16 32274111 missense probably benign 0.01
R7196:Smco1 UTSW 16 32273802 missense probably damaging 1.00
R7227:Smco1 UTSW 16 32274015 missense possibly damaging 0.93
R7517:Smco1 UTSW 16 32273967 missense possibly damaging 0.88
R7587:Smco1 UTSW 16 32273723 missense probably benign 0.01
Z1088:Smco1 UTSW 16 32273215 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTTCCGAAATTCGCAGCTG -3'
(R):5'- CATCCGTCTTACGTTGGCAG -3'

Sequencing Primer
(F):5'- TTAAGGAGCTTTGCCCGT -3'
(R):5'- CCGTCTTACGTTGGCAGCATAG -3'
Posted On2015-04-17