Mutagenetix > Incidental Mutation

Incidental Mutation 'R3915:Ikzf3'

309609

Institutional Source

Beutler Lab

Gene Symbol

Ikzf3

Ensembl Gene

ENSMUSG00000018168

Gene Name

IKAROS family zinc finger 3

Synonyms

Zfpn1a3, Aiolos, 5830411O07Rik

MMRRC Submission

040913-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98464902-98546031 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98490586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 56 (D56G)

Ref Sequence

ENSEMBL: ENSMUSP00000099430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103141]

AlphaFold

O08900

Predicted Effect

probably damaging
Transcript: ENSMUST00000103141
AA Change: D56G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099430
Gene: ENSMUSG00000018168
AA Change: D56G

Domain	Start	End	E-Value	Type
ZnF_C2H2	117	139	4.34e0	SMART
ZnF_C2H2	145	167	8.02e-5	SMART
ZnF_C2H2	173	195	4.47e-3	SMART
ZnF_C2H2	201	221	7.11e0	SMART
ZnF_C2H2	450	472	7.11e0	SMART
ZnF_C2H2	478	502	1.64e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140876

Meta Mutation Damage Score

0.1033

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.6%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This gene product is a transcription factor that is important in the regulation of B lymphocyte proliferation and differentiation. Both Ikaros and Aiolos can participate in chromatin remodeling. Regulation of gene expression in B lymphocytes by Aiolos is complex as it appears to require the sequential formation of Ikaros homodimers, Ikaros/Aiolos heterodimers, and Aiolos homodimers. Several alternative transcripts encoding different isoforms have been described, as well as some non-protein coding variants. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mutants exhibit greatly reduced B cell populations in the peritoneum, marginal zone and recirculating bone marrow. Aging mutants express autoantibodies, frequently develop B cell lymphomas, and display symptoms characteristic of SLE. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700109H08Rik	G	A	5: 3,577,248	V75I	possibly damaging	Het
AA986860	A	G	1: 130,742,607	K189E	probably benign	Het
Abcf1	C	T	17: 35,959,510	R596H	possibly damaging	Het
Axl	T	C	7: 25,760,744		probably benign	Het
Birc6	A	G	17: 74,579,608	K644E	probably benign	Het
Btbd11	C	A	10: 85,632,270	H810N	probably damaging	Het
Btnl7-ps	T	A	17: 34,541,515		noncoding transcript	Het
Car8	A	T	4: 8,184,576		probably benign	Het
Ccdc62	C	T	5: 123,954,715	R588C	probably damaging	Het
Clasp2	T	G	9: 113,908,737	S374A	probably damaging	Het
Ctnnb1	A	G	9: 120,955,651	H503R	probably benign	Het
Cwf19l2	A	G	9: 3,456,776	H703R	probably damaging	Het
Efcab7	A	T	4: 99,878,173	Q133L	probably damaging	Het
Ehmt2	T	C	17: 34,903,467	S280P	probably damaging	Het
Eomes	A	G	9: 118,481,273	M351V	probably benign	Het
Ets2	G	A	16: 95,718,993	R421H	probably damaging	Het
Fam222b	C	G	11: 78,154,930	P439R	probably benign	Het
Gbp11	T	A	5: 105,331,112	K153N	probably damaging	Het
Gm8989	A	G	7: 106,330,238	S151P	probably benign	Het
Gm8994	A	T	6: 136,329,422	T294S	probably benign	Het
Golim4	T	C	3: 75,903,327	T174A	probably damaging	Het
Grid1	A	G	14: 35,520,727	Y679C	probably damaging	Het
Kcnj16	A	G	11: 111,025,556	D348G	probably benign	Het
Kidins220	T	C	12: 25,053,958	L1319P	possibly damaging	Het
Lrp1b	T	A	2: 41,449,236	D751V	probably damaging	Het
Macc1	T	C	12: 119,446,816	C440R	probably benign	Het
Mbd2	T	C	18: 70,622,609	V382A	probably benign	Het
Olfr45	T	A	7: 140,690,975	D23E	probably benign	Het
Olfr559	C	T	7: 102,724,202	R96H	possibly damaging	Het
Olfr780	G	A	10: 129,322,309	A229T	probably benign	Het
Pgs1	T	G	11: 118,019,646	S528A	probably benign	Het
Pitpnm3	T	C	11: 72,112,284	T67A	probably damaging	Het
Pnliprp2	T	G	19: 58,760,362	V33G	probably damaging	Het
Ptn	T	C	6: 36,743,347	N90S	probably damaging	Het
Ptprt	A	T	2: 161,555,555		probably benign	Het
Ranbp17	G	A	11: 33,479,189	A352V	probably benign	Het
Rasgrp1	G	A	2: 117,288,641	S505F	probably damaging	Het
Sesn1	G	A	10: 41,894,890	R139H	probably benign	Het
Slc17a7	T	A	7: 45,168,720	L23Q	probably damaging	Het
Slc30a10	G	T	1: 185,455,136	E25*	probably null	Het
Smco1	A	G	16: 32,273,765	I85V	probably benign	Het
Vmn1r76	A	T	7: 11,930,569	S239R	probably benign	Het
Zc3h7a	A	T	16: 11,156,210	V237D	possibly damaging	Het

Other mutations in Ikzf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01477:Ikzf3	APN	11	98488857	missense	probably damaging	1.00
IGL01537:Ikzf3	APN	11	98516892	missense	probably damaging	1.00
IGL03376:Ikzf3	APN	11	98488953	missense	probably damaging	1.00
R0030:Ikzf3	UTSW	11	98467612	missense	probably benign	0.01
R0266:Ikzf3	UTSW	11	98467317	missense	probably benign
R1302:Ikzf3	UTSW	11	98516920	missense	probably benign
R1464:Ikzf3	UTSW	11	98516905	missense	probably benign	0.00
R1464:Ikzf3	UTSW	11	98516905	missense	probably benign	0.00
R1500:Ikzf3	UTSW	11	98518695	missense	probably benign	0.16
R1531:Ikzf3	UTSW	11	98490446	missense	probably damaging	0.98
R1599:Ikzf3	UTSW	11	98467093	missense	probably damaging	1.00
R1623:Ikzf3	UTSW	11	98490331	critical splice donor site	probably null
R2154:Ikzf3	UTSW	11	98485649	nonsense	probably null
R4004:Ikzf3	UTSW	11	98489017	missense	probably damaging	1.00
R4005:Ikzf3	UTSW	11	98489017	missense	probably damaging	1.00
R4075:Ikzf3	UTSW	11	98467643	nonsense	probably null
R4210:Ikzf3	UTSW	11	98490487	missense	probably benign	0.00
R4804:Ikzf3	UTSW	11	98490574	missense	probably benign	0.20
R5107:Ikzf3	UTSW	11	98490476	missense	probably damaging	1.00
R5266:Ikzf3	UTSW	11	98490580	missense	probably benign	0.11
R5267:Ikzf3	UTSW	11	98490580	missense	probably benign	0.11
R5450:Ikzf3	UTSW	11	98467086	missense	probably damaging	1.00
R6237:Ikzf3	UTSW	11	98467053	missense	probably damaging	1.00
R6557:Ikzf3	UTSW	11	98516881	missense	probably benign
R7832:Ikzf3	UTSW	11	98518699	missense	probably benign
R8058:Ikzf3	UTSW	11	98516927	nonsense	probably null
R8073:Ikzf3	UTSW	11	98467429	missense	probably benign	0.05
R9564:Ikzf3	UTSW	11	98467206	missense	probably damaging	1.00
Z1176:Ikzf3	UTSW	11	98467181	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAGCTAATGCAGGATAACCCGC -3'
(R):5'- TGTGGTTCCGAATTCAAACAG -3'

Sequencing Primer
(F):5'- GCACACGTCGCAGTTCATC -3'
(R):5'- AGTGAATGGTCTCCCTCACAG -3'

Posted On

2015-04-17