Incidental Mutation 'R3749:Cfhr1'
ID310070
Institutional Source Beutler Lab
Gene Symbol Cfhr1
Ensembl Gene ENSMUSG00000057037
Gene Namecomplement factor H-related 1
SynonymsCfhl1
MMRRC Submission 040734-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R3749 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location139547053-139560272 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) C to A at 139557634 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023965]
Predicted Effect probably null
Transcript: ENSMUST00000023965
SMART Domains Protein: ENSMUSP00000023965
Gene: ENSMUSG00000057037

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CCP 28 88 1.12e-4 SMART
CCP 92 145 3.48e-10 SMART
CCP 154 208 4.95e-15 SMART
CCP 215 269 3.5e-15 SMART
CCP 273 334 1.04e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161224
Meta Mutation Damage Score 0.8527 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein belonging to the complement factor H protein family. It binds to Pseudomonas aeruginosa elongation factor Tuf together with plasminogen, which is proteolytically activated. It is proposed that Tuf acts as a virulence factor by acquiring host proteins to the pathogen surface, controlling complement, and facilitating tissue invasion. Mutations in this gene are associated with an increased risk of atypical hemolytic-uremic syndrome. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam19 A T 11: 46,137,610 D690V probably benign Het
Ankib1 G T 5: 3,734,097 P293Q probably damaging Het
Arhgap19 T A 19: 41,774,079 E461V probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Colq A T 14: 31,549,453 probably benign Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Faap24 A T 7: 35,393,012 V160D possibly damaging Het
Gpc1 C A 1: 92,857,582 C414* probably null Het
Igkv9-120 G A 6: 68,050,001 A7T probably benign Het
Kcnu1 T A 8: 25,886,770 C391S probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
March6 A G 15: 31,462,014 V856A probably benign Het
Mfsd1 T C 3: 67,582,953 S46P probably benign Het
Mme T A 3: 63,343,540 V334E probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Obsl1 T C 1: 75,498,246 T642A probably benign Het
Olfm1 C T 2: 28,208,088 T54I probably damaging Het
Olfr803 C T 10: 129,691,961 V27I probably benign Het
Olfr95 G A 17: 37,211,800 R18C possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Patj A G 4: 98,469,600 Y701C probably damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc25a25 G T 2: 32,420,380 N122K probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Syne1 C T 10: 5,052,267 probably benign Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Terb1 T C 8: 104,496,834 D114G probably damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Tpi1 T A 6: 124,812,791 S130C probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Uggt2 A T 14: 119,057,672 V38E probably benign Het
Vmn1r158 A C 7: 22,790,214 L190W probably damaging Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Wnt2 T C 6: 18,023,168 I161V probably benign Het
Zdhhc25 C T 15: 88,601,023 S187L probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zkscan1 T C 5: 138,101,441 S476P probably damaging Het
Zmynd8 A G 2: 165,805,198 Y945H probably damaging Het
Other mutations in Cfhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Cfhr1 APN 1 139556515 unclassified probably benign
IGL00656:Cfhr1 APN 1 139547755 unclassified probably benign
IGL01099:Cfhr1 APN 1 139547759 unclassified probably benign
IGL01101:Cfhr1 APN 1 139553584 missense probably benign 0.11
IGL01617:Cfhr1 APN 1 139553679 nonsense probably null
IGL01732:Cfhr1 APN 1 139550868 missense probably benign 0.02
IGL01935:Cfhr1 APN 1 139551002 missense probably benign 0.26
IGL02368:Cfhr1 APN 1 139547813 unclassified probably benign
IGL02456:Cfhr1 APN 1 139556393 missense possibly damaging 0.88
IGL03105:Cfhr1 APN 1 139547827 unclassified probably benign
R0681:Cfhr1 UTSW 1 139557511 missense probably damaging 0.99
R1466:Cfhr1 UTSW 1 139557574 missense probably benign 0.17
R1466:Cfhr1 UTSW 1 139557574 missense probably benign 0.17
R1829:Cfhr1 UTSW 1 139553600 missense probably damaging 1.00
R2082:Cfhr1 UTSW 1 139550886 missense possibly damaging 0.72
R2118:Cfhr1 UTSW 1 139550904 missense probably benign 0.01
R3747:Cfhr1 UTSW 1 139557634 critical splice acceptor site probably null
R3748:Cfhr1 UTSW 1 139557634 critical splice acceptor site probably null
R4208:Cfhr1 UTSW 1 139547878 unclassified probably benign
R4566:Cfhr1 UTSW 1 139553648 missense possibly damaging 0.82
R4681:Cfhr1 UTSW 1 139550929 nonsense probably null
R4839:Cfhr1 UTSW 1 139560133 missense probably damaging 1.00
R5208:Cfhr1 UTSW 1 139556330 critical splice donor site probably null
R5572:Cfhr1 UTSW 1 139556427 missense possibly damaging 0.78
R6043:Cfhr1 UTSW 1 139550868 missense probably benign 0.01
R6176:Cfhr1 UTSW 1 139550916 missense probably damaging 1.00
R7643:Cfhr1 UTSW 1 139553585 missense possibly damaging 0.47
R7689:Cfhr1 UTSW 1 139547740 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGAGACACTTCGGAGTTGG -3'
(R):5'- GCCTGACAAGGGAGATAAACATTC -3'

Sequencing Primer
(F):5'- ACACTTCGGAGTTGGTGACCATC -3'
(R):5'- TTCATAGCCAGGGACATCACTG -3'
Posted On2015-04-17