Incidental Mutation 'R3749:Wnt2'
ID310090
Institutional Source Beutler Lab
Gene Symbol Wnt2
Ensembl Gene ENSMUSG00000010797
Gene Namewingless-type MMTV integration site family, member 2
Synonymsm-irp, Irp, 2610510E18Rik, Int1l1, Mirp, Wnt2a, Wnt-2
MMRRC Submission 040734-MU
Accession Numbers

Genbank: NM_023653.5; Ensembl: ENSMUST00000010941

Is this an essential gene? Possibly non essential (E-score: 0.487) question?
Stock #R3749 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location17988940-18030585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18023168 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 161 (I161V)
Ref Sequence ENSEMBL: ENSMUSP00000010941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010941]
Predicted Effect probably benign
Transcript: ENSMUST00000010941
AA Change: I161V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000010941
Gene: ENSMUSG00000010797
AA Change: I161V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
WNT1 43 349 5.1e-213 SMART
Meta Mutation Damage Score 0.0968 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WNT gene family. The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit impaired placental vascularization, runting and 50% perinatal mortality resulting from difficulties in breathing and nursing. Survivors of the perinatal period tend to recover, and adults are healthy and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 T C 7: 134,172,865 D5G probably damaging Het
Adam19 A T 11: 46,137,610 D690V probably benign Het
Ankib1 G T 5: 3,734,097 P293Q probably damaging Het
Arhgap19 T A 19: 41,774,079 E461V probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bub1b T A 2: 118,615,455 N319K possibly damaging Het
Ccdc40 T C 11: 119,264,426 V1164A probably benign Het
Cfhr1 C A 1: 139,557,634 probably null Het
Colq A T 14: 31,549,453 probably benign Het
Daam1 C A 12: 71,971,166 D716E probably damaging Het
Dnah17 T C 11: 118,082,916 S1935G probably benign Het
Dnah8 A T 17: 30,784,174 K3616* probably null Het
Faap24 A T 7: 35,393,012 V160D possibly damaging Het
Gpc1 C A 1: 92,857,582 C414* probably null Het
Igkv9-120 G A 6: 68,050,001 A7T probably benign Het
Kcnu1 T A 8: 25,886,770 C391S probably null Het
Lrba T G 3: 86,375,953 L1858R probably damaging Het
Lrp10 A T 14: 54,469,266 N520I possibly damaging Het
March6 A G 15: 31,462,014 V856A probably benign Het
Mfsd1 T C 3: 67,582,953 S46P probably benign Het
Mme T A 3: 63,343,540 V334E probably damaging Het
Mroh2b G A 15: 4,952,246 W1513* probably null Het
Nuf2 T A 1: 169,525,376 N20I probably damaging Het
Obsl1 T C 1: 75,498,246 T642A probably benign Het
Olfm1 C T 2: 28,208,088 T54I probably damaging Het
Olfr803 C T 10: 129,691,961 V27I probably benign Het
Olfr95 G A 17: 37,211,800 R18C possibly damaging Het
Osbpl7 T C 11: 97,056,053 V223A probably damaging Het
Patj A G 4: 98,469,600 Y701C probably damaging Het
Pkdrej T A 15: 85,821,077 K219N probably damaging Het
Scn2a T G 2: 65,713,771 V832G probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc25a25 G T 2: 32,420,380 N122K probably benign Het
Slk T G 19: 47,619,809 D400E possibly damaging Het
Spon1 T C 7: 113,766,384 L19P probably damaging Het
Spon1 T A 7: 114,016,791 V297E possibly damaging Het
Supt16 A G 14: 52,180,139 L306P probably damaging Het
Syne1 C T 10: 5,052,267 probably benign Het
Tas2r136 A T 6: 132,777,237 F309Y probably damaging Het
Terb1 T C 8: 104,496,834 D114G probably damaging Het
Tlr5 T C 1: 182,974,439 I436T probably benign Het
Tpcn2 T C 7: 145,255,523 H682R probably damaging Het
Tpi1 T A 6: 124,812,791 S130C probably damaging Het
Ttn G A 2: 76,754,006 H22253Y probably damaging Het
Uggt2 A T 14: 119,057,672 V38E probably benign Het
Vmn1r158 A C 7: 22,790,214 L190W probably damaging Het
Vwa5b2 A G 16: 20,598,326 probably benign Het
Zdhhc25 C T 15: 88,601,023 S187L probably benign Het
Zfhx4 G A 3: 5,243,165 E484K possibly damaging Het
Zkscan1 T C 5: 138,101,441 S476P probably damaging Het
Zmynd8 A G 2: 165,805,198 Y945H probably damaging Het
Other mutations in Wnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03264:Wnt2 APN 6 17989960 missense probably benign 0.22
1mM(1):Wnt2 UTSW 6 18008623 missense probably damaging 1.00
R1165:Wnt2 UTSW 6 17989947 missense probably benign
R1771:Wnt2 UTSW 6 18008697 missense probably damaging 0.97
R1782:Wnt2 UTSW 6 18008640 missense possibly damaging 0.65
R1836:Wnt2 UTSW 6 18023235 missense probably damaging 1.00
R1921:Wnt2 UTSW 6 18030253 missense unknown
R2009:Wnt2 UTSW 6 18030209 missense probably damaging 0.98
R4831:Wnt2 UTSW 6 18023286 missense probably benign 0.19
R4888:Wnt2 UTSW 6 18023126 missense possibly damaging 0.89
R4924:Wnt2 UTSW 6 18023240 missense probably damaging 1.00
R5121:Wnt2 UTSW 6 18023126 missense possibly damaging 0.89
R5660:Wnt2 UTSW 6 18028146 missense probably benign 0.09
R5767:Wnt2 UTSW 6 17990028 missense probably damaging 0.97
R6005:Wnt2 UTSW 6 18030323 start gained probably benign
R6670:Wnt2 UTSW 6 18028092 missense possibly damaging 0.90
R7205:Wnt2 UTSW 6 18028047 missense probably benign 0.11
R7711:Wnt2 UTSW 6 17990037 missense probably benign 0.44
R7732:Wnt2 UTSW 6 18023336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGCTCTGTCTCAGTGAGTC -3'
(R):5'- AGAACACTTGGAGAGACGCTC -3'

Sequencing Primer
(F):5'- CTCTGTCTCAGTGAGTCACAAGAG -3'
(R):5'- GCTCTCTGACCGCTTTTAAGAAAGG -3'
Posted On2015-04-17