Incidental Mutation 'R3955:Olfr566'
ID310648
Institutional Source Beutler Lab
Gene Symbol Olfr566
Ensembl Gene ENSMUSG00000060888
Gene Nameolfactory receptor 566
SynonymsMOR14-7P, GA_x6K02T2PBJ9-5560696-5559746
MMRRC Submission 040832-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R3955 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102855337-102858765 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102856617 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 222 (C222R)
Ref Sequence ENSEMBL: ENSMUSP00000148998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071393] [ENSMUST00000209952] [ENSMUST00000213481]
Predicted Effect probably damaging
Transcript: ENSMUST00000071393
AA Change: C219R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071344
Gene: ENSMUSG00000060888
AA Change: C219R

DomainStartEndE-ValueType
Pfam:7tm_4 37 316 1e-110 PFAM
Pfam:7TM_GPCR_Srsx 42 313 3.5e-6 PFAM
Pfam:7tm_1 47 298 9.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209952
AA Change: C222R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210522
Predicted Effect probably damaging
Transcript: ENSMUST00000213481
AA Change: C222R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.4469 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,068,073 T1008A probably benign Het
6030419C18Rik A T 9: 58,499,623 D272V probably damaging Het
Abcc5 G C 16: 20,405,543 H97D probably damaging Het
Acbd7 T C 2: 3,336,213 S2P probably benign Het
Acta2 G T 19: 34,251,726 probably benign Het
Adam2 G A 14: 66,057,610 S262L probably damaging Het
C130060K24Rik A T 6: 65,453,108 I263L possibly damaging Het
Cd69 A T 6: 129,268,380 probably null Het
Cpsf3 A G 12: 21,313,805 D632G probably benign Het
Dennd5a A G 7: 109,905,699 M868T probably benign Het
Dscc1 T C 15: 55,083,553 T259A probably benign Het
Dsg4 G A 18: 20,449,375 probably null Het
Fam58b C A 11: 78,751,023 E214* probably null Het
Gm996 G T 2: 25,577,571 S776* probably null Het
Igfn1 A G 1: 135,967,180 Y1883H possibly damaging Het
Krt20 G A 11: 99,432,211 Q262* probably null Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lmod2 G T 6: 24,603,871 V282L probably benign Het
Lrrc49 A G 9: 60,671,359 I228T probably damaging Het
Matn1 G A 4: 130,951,415 probably null Het
Nek7 C A 1: 138,534,389 C79F probably damaging Het
Nmt2 A G 2: 3,312,498 D132G probably benign Het
Nup210l A T 3: 90,193,054 R1462S possibly damaging Het
Obscn G A 11: 59,036,768 S6118F probably damaging Het
Olfr1042 A G 2: 86,159,938 V144A probably benign Het
Olfr1259 T A 2: 89,943,828 M96L possibly damaging Het
Olfr127 A T 17: 37,903,609 H21L probably benign Het
Olfr50 T A 2: 36,793,553 L106M probably benign Het
Plxnb3 T C X: 73,771,220 V1789A probably benign Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Rab3gap1 A G 1: 127,934,517 Q675R probably damaging Het
Rasgrf2 A G 13: 91,982,855 S696P probably damaging Het
Sergef T A 7: 46,618,752 E210V possibly damaging Het
Sik3 C A 9: 46,198,593 N541K probably damaging Het
Slc26a1 T C 5: 108,673,582 D147G possibly damaging Het
Tbc1d14 G A 5: 36,543,215 R270* probably null Het
Tbc1d9 C T 8: 83,233,532 T138I probably damaging Het
Tdp2 C T 13: 24,836,099 T123I probably benign Het
Tec T C 5: 72,782,177 probably null Het
Tmf1 C A 6: 97,176,206 R302L probably damaging Het
Tnip3 A T 6: 65,597,395 T137S possibly damaging Het
Trim30d C T 7: 104,472,521 G339D probably damaging Het
Tspan32 T A 7: 143,006,998 M61K probably damaging Het
Ttc6 T C 12: 57,697,452 V1290A probably benign Het
Ttn A G 2: 76,969,249 V429A possibly damaging Het
Unc13b A G 4: 43,256,834 Y3962C probably damaging Het
Vmn2r95 T A 17: 18,440,096 Y257N possibly damaging Het
Zfp677 A G 17: 21,397,817 K379E possibly damaging Het
Zfp865 T A 7: 5,032,014 D999E probably damaging Het
Other mutations in Olfr566
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Olfr566 APN 7 102856824 missense probably benign
IGL03336:Olfr566 APN 7 102856616 missense probably benign 0.38
PIT4382001:Olfr566 UTSW 7 102856602 missense probably damaging 1.00
R1337:Olfr566 UTSW 7 102856871 missense probably benign 0.03
R1791:Olfr566 UTSW 7 102856362 nonsense probably null
R3953:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R3954:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R3957:Olfr566 UTSW 7 102856617 missense probably damaging 0.97
R4734:Olfr566 UTSW 7 102856979 missense probably damaging 0.99
R5182:Olfr566 UTSW 7 102856969 missense probably benign 0.07
R5394:Olfr566 UTSW 7 102856479 missense probably damaging 1.00
R5559:Olfr566 UTSW 7 102857207 missense possibly damaging 0.94
R6023:Olfr566 UTSW 7 102856962 missense possibly damaging 0.95
R6310:Olfr566 UTSW 7 102857205 missense probably benign 0.01
R7312:Olfr566 UTSW 7 102856499 missense probably damaging 1.00
R7493:Olfr566 UTSW 7 102857071 nonsense probably null
R8409:Olfr566 UTSW 7 102857270 missense probably benign 0.01
Z1177:Olfr566 UTSW 7 102856374 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATTGGCCATCATTGTATGGAC -3'
(R):5'- TTCCTAGTGATAATGCGTGCTC -3'

Sequencing Primer
(F):5'- CCATCATTGTATGGACTACCTTGGG -3'
(R):5'- ATGCGTGCTCTGTTATTAATAGTCC -3'
Posted On2015-04-29