Incidental Mutation 'R3980:Parp3'
ID311261
Institutional Source Beutler Lab
Gene Symbol Parp3
Ensembl Gene ENSMUSG00000023249
Gene Namepoly (ADP-ribose) polymerase family, member 3
SynonymsA930002C11Rik, PARP-3, Adprt3, Adprtl3
MMRRC Submission 040843-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3980 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location106470322-106476949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106474068 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 278 (D278G)
Ref Sequence ENSEMBL: ENSMUSP00000149572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047721] [ENSMUST00000067218] [ENSMUST00000112479] [ENSMUST00000123555] [ENSMUST00000125850] [ENSMUST00000156426] [ENSMUST00000214682]
Predicted Effect probably benign
Transcript: ENSMUST00000047721
SMART Domains Protein: ENSMUSP00000038580
Gene: ENSMUSG00000041506

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
coiled coil region 61 102 N/A INTRINSIC
WD40 135 174 1.15e-4 SMART
WD40 177 227 3.09e-5 SMART
WD40 230 269 2.42e-7 SMART
WD40 272 311 9.24e-4 SMART
WD40 313 351 2.4e-2 SMART
WD40 354 404 4.6e0 SMART
Blast:WD40 412 451 1e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000067218
AA Change: D278G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064513
Gene: ENSMUSG00000023249
AA Change: D278G

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 176 315 8.7e-39 PFAM
Pfam:PARP 317 528 7.1e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112479
AA Change: D283G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108098
Gene: ENSMUSG00000023249
AA Change: D283G

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 182 319 1.3e-42 PFAM
Pfam:PARP 322 533 7.3e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123464
Predicted Effect possibly damaging
Transcript: ENSMUST00000123555
AA Change: D278G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123054
Gene: ENSMUSG00000023249
AA Change: D278G

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 176 315 8.7e-39 PFAM
Pfam:PARP 317 528 7.1e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125630
Predicted Effect probably benign
Transcript: ENSMUST00000125850
SMART Domains Protein: ENSMUSP00000119244
Gene: ENSMUSG00000023249

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145396
Predicted Effect probably benign
Transcript: ENSMUST00000156426
SMART Domains Protein: ENSMUSP00000117329
Gene: ENSMUSG00000023249

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
PDB:4L7U|A 179 202 6e-7 PDB
SCOP:d1a26_1 182 202 5e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000214682
AA Change: D278G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217303
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PARP family. These enzymes modify nuclear proteins by poly-ADP-ribosylation, which is required for DNA repair, regulation of apoptosis, and maintenance of genomic stability. This gene encodes the poly(ADP-ribosyl)transferase 3, which is preferentially localized to the daughter centriole throughout the cell cycle. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,582,943 G268R probably damaging Het
Amacr T A 15: 10,988,929 Y240* probably null Het
Ankhd1 A T 18: 36,647,613 H1906L probably damaging Het
Arhgef25 C A 10: 127,187,220 C106F probably damaging Het
Bean1 A T 8: 104,211,098 Q103L possibly damaging Het
Ccr9 A T 9: 123,779,376 N41I probably benign Het
Ceacam16 A G 7: 19,858,633 F117L probably benign Het
Col4a1 T C 8: 11,239,155 probably benign Het
Csk A G 9: 57,630,780 Y48H probably damaging Het
Csmd1 T A 8: 15,906,056 K3384* probably null Het
Ctnnd2 T A 15: 30,669,443 H399Q probably benign Het
Cutal T C 2: 34,882,313 Y30H possibly damaging Het
Cybb T C X: 9,444,588 Y425C probably damaging Het
Dab2 A G 15: 6,435,163 probably null Het
Defb30 C A 14: 63,035,972 C64F probably damaging Het
Eif2a T C 3: 58,539,539 I45T probably benign Het
Esyt1 T A 10: 128,511,524 D1044V probably damaging Het
Fam196b G A 11: 34,402,678 C240Y probably benign Het
Gabpb2 A T 3: 95,188,770 V382E probably damaging Het
Glb1 T A 9: 114,417,064 I61K probably damaging Het
Kcnt1 T C 2: 25,893,214 V263A possibly damaging Het
Kdm5b A G 1: 134,619,670 D1019G probably benign Het
Klhl2 A T 8: 64,743,075 L545M probably damaging Het
Klhl2 C A 8: 64,743,081 G543C probably damaging Het
Krt31 G T 11: 100,048,204 Q264K probably damaging Het
Lmnb1 A G 18: 56,731,019 D232G probably damaging Het
Loxhd1 T C 18: 77,414,159 F859L probably damaging Het
Map7 C A 10: 20,267,353 T416K unknown Het
Med18 T A 4: 132,462,940 I45F probably benign Het
Mn1 A T 5: 111,421,770 H1202L possibly damaging Het
Mpp7 T C 18: 7,444,062 D120G probably benign Het
Nlrp1b A T 11: 71,181,611 F469I possibly damaging Het
Nos3 T A 5: 24,377,931 D685E probably damaging Het
Nrap G A 19: 56,381,552 A206V probably benign Het
Nuggc T C 14: 65,619,093 probably null Het
Oasl1 C T 5: 114,932,898 T274I probably damaging Het
Olfr1335 T A 4: 118,809,303 Y187F probably benign Het
Olfr559 T C 7: 102,723,752 N246S probably damaging Het
Phc3 T A 3: 30,936,931 Q346L probably damaging Het
Pigo A G 4: 43,019,231 L1029P probably damaging Het
Plcb3 A G 19: 6,966,435 I66T probably damaging Het
Plch2 T C 4: 154,984,798 S1019G probably benign Het
Plekhg6 C A 6: 125,373,183 C264F probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pou4f2 G T 8: 78,435,438 H179N possibly damaging Het
Prpf39 T C 12: 65,061,457 probably benign Het
Rapgef1 G A 2: 29,719,650 V700I probably benign Het
Rdh14 A G 12: 10,394,703 I185V probably benign Het
Rnf111 A T 9: 70,442,325 H785Q probably damaging Het
Rttn C T 18: 89,017,275 R758W probably benign Het
Sik3 G A 9: 46,202,063 V601M probably damaging Het
Slc22a14 T C 9: 119,178,486 T286A probably benign Het
Slc36a3 G A 11: 55,135,383 T203I probably benign Het
Spata31 A T 13: 64,922,654 Q872L probably benign Het
Spata31d1c A G 13: 65,035,160 D172G possibly damaging Het
Sphkap A T 1: 83,267,494 probably null Het
Stat6 T C 10: 127,655,379 V463A probably damaging Het
Stx7 T C 10: 24,185,049 S225P probably damaging Het
Sult2a7 A T 7: 14,473,409 probably benign Het
Tada2a A T 11: 84,103,120 F179L probably benign Het
Tas2r103 A G 6: 133,036,317 L262P probably benign Het
Tfap2d A G 1: 19,165,963 I382V possibly damaging Het
Tshr C A 12: 91,537,743 A485D probably damaging Het
Vmn1r32 T A 6: 66,553,714 Y26F probably damaging Het
Vmn1r5 A G 6: 56,985,651 T104A probably damaging Het
Wbp1l T A 19: 46,653,957 probably null Het
Other mutations in Parp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Parp3 APN 9 106471387 missense probably benign
IGL00827:Parp3 APN 9 106474406 missense probably benign 0.17
IGL02683:Parp3 APN 9 106473185 missense possibly damaging 0.84
R0050:Parp3 UTSW 9 106471401 missense possibly damaging 0.81
R0110:Parp3 UTSW 9 106471796 missense possibly damaging 0.81
R0320:Parp3 UTSW 9 106475812 missense possibly damaging 0.76
R0510:Parp3 UTSW 9 106471796 missense possibly damaging 0.81
R0989:Parp3 UTSW 9 106473082 splice site probably null
R1170:Parp3 UTSW 9 106476005 intron probably benign
R1919:Parp3 UTSW 9 106475117 missense possibly damaging 0.92
R1935:Parp3 UTSW 9 106474732 missense probably damaging 1.00
R1936:Parp3 UTSW 9 106474732 missense probably damaging 1.00
R1958:Parp3 UTSW 9 106474822 unclassified probably null
R2188:Parp3 UTSW 9 106475852 missense probably damaging 0.99
R2919:Parp3 UTSW 9 106473725 missense possibly damaging 0.84
R3014:Parp3 UTSW 9 106471315 missense possibly damaging 0.66
R3429:Parp3 UTSW 9 106474723 missense probably damaging 0.99
R3430:Parp3 UTSW 9 106474723 missense probably damaging 0.99
R3618:Parp3 UTSW 9 106475063 missense possibly damaging 0.81
R4840:Parp3 UTSW 9 106473109 missense probably damaging 1.00
R5617:Parp3 UTSW 9 106474505 missense possibly damaging 0.75
R6015:Parp3 UTSW 9 106474282 missense possibly damaging 0.72
R6591:Parp3 UTSW 9 106473692 missense probably benign
R6691:Parp3 UTSW 9 106473692 missense probably benign
R7403:Parp3 UTSW 9 106474853 missense probably benign 0.35
R7612:Parp3 UTSW 9 106474194 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGATAACGGGCACTGGACC -3'
(R):5'- TGACCAAGCAGCAGATTGCC -3'

Sequencing Primer
(F):5'- ATAACGGGCACTGGACCTTGTC -3'
(R):5'- CAGCAGATTGCCCGTGG -3'
Posted On2015-04-29