Incidental Mutation 'R4128:Hsd17b14'
ID315473
Institutional Source Beutler Lab
Gene Symbol Hsd17b14
Ensembl Gene ENSMUSG00000030825
Gene Namehydroxysteroid (17-beta) dehydrogenase 14
Synonyms0610039E24Rik, Dhrs10, retSDR3
MMRRC Submission 041635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4128 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45554893-45567752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45563008 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 155 (V155M)
Ref Sequence ENSEMBL: ENSMUSP00000147715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107752] [ENSMUST00000210300]
Predicted Effect probably damaging
Transcript: ENSMUST00000107752
AA Change: V155M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103381
Gene: ENSMUSG00000030825
AA Change: V155M

DomainStartEndE-ValueType
Pfam:KR 10 187 4.3e-12 PFAM
Pfam:adh_short 10 200 2.9e-53 PFAM
Pfam:Epimerase 12 184 4.2e-7 PFAM
Pfam:adh_short_C2 16 250 8.3e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115479
AA Change: V121M
Predicted Effect probably damaging
Transcript: ENSMUST00000133242
AA Change: V155M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121017
Gene: ENSMUSG00000030825
AA Change: V155M

DomainStartEndE-ValueType
Pfam:adh_short 10 163 9.9e-29 PFAM
Pfam:KR 10 177 2e-13 PFAM
Pfam:Epimerase 12 161 2.3e-8 PFAM
Pfam:3Beta_HSD 13 152 5.1e-7 PFAM
Pfam:adh_short_C2 16 159 4.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141247
AA Change: R156H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147958
AA Change: V65M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209745
Predicted Effect probably damaging
Transcript: ENSMUST00000210300
AA Change: V155M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210569
Predicted Effect probably benign
Transcript: ENSMUST00000210997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211029
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] 17-beta-hydroxysteroid dehydrogenases, such as HSD17B14, are primarily involved in metabolism of steroids at the C17 position and also of other substrates, such as fatty acids, prostaglandins, and xenobiotics (Lukacik et al., 2007 [PubMed 17067289]).[supplied by OMIM, Jun 2009]
PHENOTYPE: In a high-throughput phenotyping screen, male null mice exhibit infertility, decreased sperm production, testicular degeneration and an increased anxiety-like response to stress-induced hyperthermia. Homozygous null mice also show an increase in serum IgG2a in response to antigen challenge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 C T 3: 95,681,672 R483Q probably benign Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Cavin2 A G 1: 51,301,422 *419W probably null Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Csl T C 10: 99,758,600 D201G probably benign Het
Erap1 T C 13: 74,666,196 I33T probably damaging Het
Ermap T C 4: 119,187,111 T163A possibly damaging Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Igf2bp2 C T 16: 22,078,621 V281I probably benign Het
Ighj4 T C 12: 113,428,556 probably benign Het
Ireb2 T A 9: 54,881,432 D63E probably benign Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Kcnj11 A G 7: 46,099,719 F60S probably damaging Het
Lyplal1 A G 1: 186,089,539 C129R possibly damaging Het
Mertk C T 2: 128,777,438 Q539* probably null Het
Myrip C A 9: 120,464,698 S753* probably null Het
Narf G A 11: 121,250,435 probably null Het
Neb C A 2: 52,292,700 L1051F probably damaging Het
Nid1 T C 13: 13,476,372 V498A probably damaging Het
Olfr509 T C 7: 108,646,426 N50S probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Rab39 T A 9: 53,686,504 I154L probably benign Het
Rnf187 A T 11: 58,934,057 S220T probably benign Het
Stac C A 9: 111,604,058 probably null Het
Stxbp3 T C 3: 108,794,831 Q553R probably benign Het
Tmem179 A T 12: 112,511,027 F8I possibly damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Unc13c C A 9: 73,734,537 A1225S probably damaging Het
Zranb1 C A 7: 132,966,552 S313* probably null Het
Other mutations in Hsd17b14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hsd17b14 APN 7 45566713 missense possibly damaging 0.72
IGL02504:Hsd17b14 APN 7 45556375 missense possibly damaging 0.84
IGL03126:Hsd17b14 APN 7 45556079 missense possibly damaging 0.83
IGL03279:Hsd17b14 APN 7 45566193 missense possibly damaging 0.72
IGL03493:Hsd17b14 APN 7 45556091 missense probably damaging 1.00
R0085:Hsd17b14 UTSW 7 45556410 unclassified probably benign
R4513:Hsd17b14 UTSW 7 45562915 missense probably benign 0.24
R5903:Hsd17b14 UTSW 7 45565962 missense probably damaging 1.00
R6649:Hsd17b14 UTSW 7 45556076 missense probably damaging 1.00
R6899:Hsd17b14 UTSW 7 45562928 missense possibly damaging 0.90
R7541:Hsd17b14 UTSW 7 45566146 missense probably damaging 1.00
R7829:Hsd17b14 UTSW 7 45566785 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CACAGTCCCACACTTGAGGATG -3'
(R):5'- GCCCTAAACAGTGGGATCTAGC -3'

Sequencing Primer
(F):5'- CCCACACTTGAGGATGTTGGTG -3'
(R):5'- GAGTAGAAACGAACTCTCAACTTG -3'
Posted On2015-05-14