Incidental Mutation 'R4128:Ermap'
ID315470
Institutional Source Beutler Lab
Gene Symbol Ermap
Ensembl Gene ENSMUSG00000028644
Gene Nameerythroblast membrane-associated protein
Synonyms
MMRRC Submission 041635-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4128 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location119175457-119190011 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119187111 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 163 (T163A)
Ref Sequence ENSEMBL: ENSMUSP00000030396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030396] [ENSMUST00000124626] [ENSMUST00000133956] [ENSMUST00000138395] [ENSMUST00000141227] [ENSMUST00000150864] [ENSMUST00000156746]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030396
AA Change: T163A

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030396
Gene: ENSMUSG00000028644
AA Change: T163A

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
Blast:IG_like 174 260 1e-19 BLAST
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124626
AA Change: T163A

PolyPhen 2 Score 0.296 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120202
Gene: ENSMUSG00000028644
AA Change: T163A

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127574
Predicted Effect possibly damaging
Transcript: ENSMUST00000133956
AA Change: T137A

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120181
Gene: ENSMUSG00000028644
AA Change: T137A

DomainStartEndE-ValueType
IGv 42 125 9.26e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137080
Predicted Effect possibly damaging
Transcript: ENSMUST00000138395
AA Change: T163A

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123426
Gene: ENSMUSG00000028644
AA Change: T163A

DomainStartEndE-ValueType
IGv 68 151 9.26e-8 SMART
transmembrane domain 272 294 N/A INTRINSIC
coiled coil region 304 342 N/A INTRINSIC
PRY 354 406 1.15e-27 SMART
SPRY 407 532 3.25e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141227
Predicted Effect probably benign
Transcript: ENSMUST00000150864
Predicted Effect probably benign
Transcript: ENSMUST00000156746
SMART Domains Protein: ENSMUSP00000118640
Gene: ENSMUSG00000028644

DomainStartEndE-ValueType
Blast:IG 78 107 6e-14 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cell surface transmembrane protein that may act as an erythroid cell receptor, possibly as a mediator of cell adhesion. Polymorphisms in this gene are responsible for the Scianna/Radin blood group system. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl4 C T 3: 95,681,672 R483Q probably benign Het
Bbox1 A G 2: 110,270,180 V224A probably benign Het
Cavin2 A G 1: 51,301,422 *419W probably null Het
Cdk19 A G 10: 40,394,395 I67V probably benign Het
Cds2 A G 2: 132,297,271 T145A probably benign Het
Chn2 G T 6: 54,272,978 R24M probably damaging Het
Csl T C 10: 99,758,600 D201G probably benign Het
Erap1 T C 13: 74,666,196 I33T probably damaging Het
Gnas A G 2: 174,300,165 N709S possibly damaging Het
Hsd17b14 G A 7: 45,563,008 V155M probably damaging Het
Igf2bp2 C T 16: 22,078,621 V281I probably benign Het
Ighj4 T C 12: 113,428,556 probably benign Het
Ireb2 T A 9: 54,881,432 D63E probably benign Het
Jarid2 T C 13: 44,902,256 S313P probably damaging Het
Kcnj11 A G 7: 46,099,719 F60S probably damaging Het
Lyplal1 A G 1: 186,089,539 C129R possibly damaging Het
Mertk C T 2: 128,777,438 Q539* probably null Het
Myrip C A 9: 120,464,698 S753* probably null Het
Narf G A 11: 121,250,435 probably null Het
Neb C A 2: 52,292,700 L1051F probably damaging Het
Nid1 T C 13: 13,476,372 V498A probably damaging Het
Olfr509 T C 7: 108,646,426 N50S probably benign Het
Olfr761 A G 17: 37,952,790 I78T probably benign Het
Pam A G 1: 97,834,468 Y691H probably damaging Het
Poln A G 5: 34,103,951 S561P probably benign Het
Rab39 T A 9: 53,686,504 I154L probably benign Het
Rnf187 A T 11: 58,934,057 S220T probably benign Het
Stac C A 9: 111,604,058 probably null Het
Stxbp3 T C 3: 108,794,831 Q553R probably benign Het
Tmem179 A T 12: 112,511,027 F8I possibly damaging Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Ubash3a T C 17: 31,237,275 Y506H probably damaging Het
Unc13c C A 9: 73,734,537 A1225S probably damaging Het
Zranb1 C A 7: 132,966,552 S313* probably null Het
Other mutations in Ermap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ermap APN 4 119183917 missense probably damaging 1.00
IGL01402:Ermap APN 4 119187158 missense probably damaging 1.00
IGL02471:Ermap APN 4 119179963 missense probably damaging 0.99
IGL02696:Ermap APN 4 119187707 missense possibly damaging 0.89
IGL02806:Ermap APN 4 119188916 missense possibly damaging 0.91
R0017:Ermap UTSW 4 119179948 splice site probably benign
R0645:Ermap UTSW 4 119185691 missense probably benign 0.04
R0737:Ermap UTSW 4 119178510 missense probably damaging 1.00
R1204:Ermap UTSW 4 119188867 missense possibly damaging 0.91
R1239:Ermap UTSW 4 119188925 missense probably benign
R1351:Ermap UTSW 4 119181361 splice site probably null
R1597:Ermap UTSW 4 119183955 missense probably damaging 1.00
R4588:Ermap UTSW 4 119188248 intron probably benign
R4853:Ermap UTSW 4 119187254 missense probably damaging 1.00
R4906:Ermap UTSW 4 119188818 intron probably benign
R4946:Ermap UTSW 4 119183308 missense probably damaging 1.00
R5187:Ermap UTSW 4 119185818 critical splice acceptor site probably null
R6275:Ermap UTSW 4 119178550 missense probably damaging 1.00
R6301:Ermap UTSW 4 119185603 missense probably damaging 1.00
R6458:Ermap UTSW 4 119178140 missense probably damaging 1.00
R6896:Ermap UTSW 4 119187131 nonsense probably null
R6997:Ermap UTSW 4 119178613 missense probably damaging 1.00
R7445:Ermap UTSW 4 119188710 missense unknown
Z1177:Ermap UTSW 4 119185561 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAACTGTGCTTATCCAGGTC -3'
(R):5'- TCAGCGAGATGAGGTGGTATC -3'

Sequencing Primer
(F):5'- TGCTTATCCAGGTCCTATATTGG -3'
(R):5'- AGATGAGGTGGTATCGGCCC -3'
Posted On2015-05-14