Incidental Mutation 'R0389:Mbtps2'
ID31554
Institutional Source Beutler Lab
Gene Symbol Mbtps2
Ensembl Gene ENSMUSG00000046873
Gene Namemembrane-bound transcription factor peptidase, site 2
Synonyms9630032G22Rik
MMRRC Submission 038595-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0389 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location157535371-157598715 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 157568368 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 134 (T134K)
Ref Sequence ENSEMBL: ENSMUSP00000137233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058098] [ENSMUST00000065806] [ENSMUST00000112522] [ENSMUST00000149249] [ENSMUST00000179062]
Predicted Effect probably benign
Transcript: ENSMUST00000058098
SMART Domains Protein: ENSMUSP00000059471
Gene: ENSMUSG00000046873

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
Pfam:Peptidase_M50 155 514 4.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065806
AA Change: T134K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000070112
Gene: ENSMUSG00000091736
AA Change: T134K

DomainStartEndE-ValueType
ZnF_C2H2 260 284 1.79e-2 SMART
ZnF_C2H2 289 311 2.2e-2 SMART
ZnF_C2H2 317 341 8.47e-4 SMART
ZnF_C2H2 347 371 3.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000065857
Predicted Effect probably benign
Transcript: ENSMUST00000112522
SMART Domains Protein: ENSMUSP00000108141
Gene: ENSMUSG00000046873

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
Pfam:Peptidase_M50 155 214 4.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134211
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139786
Predicted Effect probably benign
Transcript: ENSMUST00000149249
SMART Domains Protein: ENSMUSP00000118134
Gene: ENSMUSG00000046873

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 30 53 N/A INTRINSIC
Pfam:Peptidase_M50 76 110 2.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179062
AA Change: T134K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000137233
Gene: ENSMUSG00000046873
AA Change: T134K

DomainStartEndE-ValueType
ZnF_C2H2 260 284 1.79e-2 SMART
ZnF_C2H2 289 311 2.2e-2 SMART
ZnF_C2H2 317 341 8.47e-4 SMART
ZnF_C2H2 347 371 3.39e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a intramembrane zinc metalloprotease, which is essential in development. This protease functions in the signal protein activation involved in sterol control of transcription and the ER stress response. Mutations in this gene have been associated with ichthyosis follicularis with atrichia and photophobia (IFAP syndrome); IFAP syndrome has been quantitatively linked to a reduction in cholesterol homeostasis and ER stress response.[provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik G A 3: 121,671,404 E30K unknown Het
Abi3bp A T 16: 56,671,307 T1319S possibly damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Adgre1 G A 17: 57,406,839 D175N possibly damaging Het
Adgrf1 T C 17: 43,303,788 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Anks1 A G 17: 27,995,952 R458G possibly damaging Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1g C T 11: 94,459,697 V441M probably damaging Het
Cadps2 A T 6: 23,321,782 V1037E possibly damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cenpq T C 17: 40,933,194 probably benign Het
Chrac1 T C 15: 73,093,527 I93T possibly damaging Het
Cntnap2 T A 6: 46,009,637 S359T probably benign Het
Col6a6 C A 9: 105,784,204 M235I probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Cyp1a2 T C 9: 57,682,025 N169D probably benign Het
Dennd1c T A 17: 57,067,649 T499S probably benign Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Eif3h C A 15: 51,799,264 V129F probably damaging Het
Eno2 A G 6: 124,762,691 F380L probably damaging Het
Ergic2 T A 6: 148,183,202 I34F probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam185a C T 5: 21,459,285 T339M probably damaging Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Fam71f2 T A 6: 29,281,392 V43E possibly damaging Het
Fasn G T 11: 120,816,182 D881E probably damaging Het
Fat1 C A 8: 44,950,348 H45Q probably benign Het
Fbxw16 A T 9: 109,432,482 C439S probably benign Het
Gba2 A T 4: 43,570,832 F280Y probably damaging Het
Gfm1 A G 3: 67,457,918 I517V probably benign Het
Gng13 C T 17: 25,718,722 Q8* probably null Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gphn A T 12: 78,590,659 I381F probably damaging Het
Grm3 T C 5: 9,504,794 N833D probably damaging Het
Gstt2 G T 10: 75,832,432 T163K probably damaging Het
Gusb A T 5: 129,998,086 V388E probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hspg2 A G 4: 137,515,423 T650A possibly damaging Het
Ints2 C T 11: 86,248,851 V306I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Klhl18 A T 9: 110,428,681 C564S probably benign Het
Krt40 T A 11: 99,541,714 R159* probably null Het
L3mbtl4 G A 17: 68,455,780 V103M probably damaging Het
Lnx2 C A 5: 147,019,040 V649L possibly damaging Het
Lpp A T 16: 24,608,241 Q39H probably damaging Het
Lrpprc A T 17: 84,753,112 probably null Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Mfng C T 15: 78,764,437 V147M possibly damaging Het
Mks1 T C 11: 87,857,928 S273P probably benign Het
Myh2 T C 11: 67,180,821 L488P probably damaging Het
Myo15 A G 11: 60,478,538 N708S probably benign Het
Myo6 A T 9: 80,292,466 N1019I probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Ncoa1 T G 12: 4,295,976 N457T probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nlrp4e C A 7: 23,355,203 N927K probably damaging Het
Npffr2 T C 5: 89,582,754 M181T probably benign Het
Nxf7 A T X: 135,584,383 C495S possibly damaging Het
Oas1g T C 5: 120,887,529 T12A probably benign Het
Olfr130 C G 17: 38,067,671 R167G possibly damaging Het
Olfr23 T A 11: 73,941,053 V269E probably benign Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Olfr591 A T 7: 103,173,283 V118E possibly damaging Het
Olfr744 T A 14: 50,618,579 L119Q probably damaging Het
Papln C T 12: 83,783,379 Q1008* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Phf2 T A 13: 48,804,489 E1016D unknown Het
Phf8 T A X: 151,552,622 D197E probably benign Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Prpf4 A G 4: 62,422,605 Y419C probably damaging Het
Prr15l C A 11: 96,934,614 Y23* probably null Het
Prr5 T A 15: 84,702,951 S301T probably benign Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Radil A G 5: 142,543,471 F186L probably damaging Het
Reg3g A T 6: 78,468,561 M1K probably null Het
Rps6ka3 A G X: 159,317,967 Y76C probably damaging Het
Rtl1 C T 12: 109,590,363 V1681I possibly damaging Het
Sfmbt1 C T 14: 30,811,507 R614C probably damaging Het
Slc12a4 A G 8: 105,951,967 S244P probably benign Het
Sptbn1 T C 11: 30,139,250 T671A possibly damaging Het
Supt16 A T 14: 52,174,113 N604K probably damaging Het
Synj2 G A 17: 6,029,783 V1096I probably benign Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tbc1d25 T C X: 8,172,869 Y140C probably damaging Het
Tdrd7 A G 4: 46,016,987 D709G probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tgfbi C A 13: 56,629,702 T333N probably benign Het
Tnk1 T C 11: 69,855,682 Y235C probably damaging Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Unc13a A G 8: 71,658,032 F464L probably benign Het
Usp17le C A 7: 104,768,460 A492S probably damaging Het
Vmn1r213 A T 13: 23,011,762 M172L probably benign Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r19 A T 6: 123,335,986 I672F possibly damaging Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Xdh T A 17: 73,898,362 H1036L probably damaging Het
Zfp930 T A 8: 69,228,296 Y214* probably null Het
Other mutations in Mbtps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2251:Mbtps2 UTSW X 157559033 missense probably benign 0.03
R2253:Mbtps2 UTSW X 157559033 missense probably benign 0.03
R5365:Mbtps2 UTSW X 157568299 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGGAAATTCGCCATCAAGACCATC -3'
(R):5'- AGCGTAGGCCAAACCATCGAAG -3'

Sequencing Primer
(F):5'- AAGACCATCGATCTGCTTCTG -3'
(R):5'- GGCGCATGGTAGCCAATAC -3'
Posted On2013-04-24