Incidental Mutation 'R0389:Fasn'
ID31512
Institutional Source Beutler Lab
Gene Symbol Fasn
Ensembl Gene ENSMUSG00000025153
Gene Namefatty acid synthase
SynonymsFAS, A630082H08Rik
MMRRC Submission 038595-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0389 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location120805846-120824547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 120816182 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 881 (D881E)
Ref Sequence ENSEMBL: ENSMUSP00000052872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055655] [ENSMUST00000206589]
Predicted Effect probably damaging
Transcript: ENSMUST00000055655
AA Change: D881E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052872
Gene: ENSMUSG00000025153
AA Change: D881E

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 1 239 6.8e-73 PFAM
Pfam:Ketoacyl-synt_C 243 360 3.7e-38 PFAM
Pfam:KAsynt_C_assoc 362 474 8.2e-46 PFAM
Pfam:Acyl_transf_1 493 810 9.5e-115 PFAM
Pfam:PS-DH 853 1169 9.9e-24 PFAM
low complexity region 1175 1204 N/A INTRINSIC
Pfam:Methyltransf_12 1238 1337 2e-9 PFAM
PKS_ER 1532 1847 1.44e-147 SMART
PKS_KR 1878 2059 2.33e-42 SMART
Pfam:PP-binding 2119 2185 1.1e-10 PFAM
Pfam:Thioesterase 2235 2494 1.6e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206589
AA Change: D881E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206637
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is a multifunctional protein. Its main function is to catalyze the synthesis of palmitate from acetyl-CoA and malonyl-CoA, in the presence of NADPH, into long-chain saturated fatty acids. In some cancer cell lines, this protein has been found to be fused with estrogen receptor-alpha (ER-alpha), in which the N-terminus of FAS is fused in-frame with the C-terminus of ER-alpha. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutation of this locus has implicated its product in embryogenesis as all homozygotes and most heterozygotes die prior to birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik G A 3: 121,671,404 E30K unknown Het
Abi3bp A T 16: 56,671,307 T1319S possibly damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Adgre1 G A 17: 57,406,839 D175N possibly damaging Het
Adgrf1 T C 17: 43,303,788 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Anks1 A G 17: 27,995,952 R458G possibly damaging Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1g C T 11: 94,459,697 V441M probably damaging Het
Cadps2 A T 6: 23,321,782 V1037E possibly damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cenpq T C 17: 40,933,194 probably benign Het
Chrac1 T C 15: 73,093,527 I93T possibly damaging Het
Cntnap2 T A 6: 46,009,637 S359T probably benign Het
Col6a6 C A 9: 105,784,204 M235I probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Cyp1a2 T C 9: 57,682,025 N169D probably benign Het
Dennd1c T A 17: 57,067,649 T499S probably benign Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Eif3h C A 15: 51,799,264 V129F probably damaging Het
Eno2 A G 6: 124,762,691 F380L probably damaging Het
Ergic2 T A 6: 148,183,202 I34F probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam185a C T 5: 21,459,285 T339M probably damaging Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Fam71f2 T A 6: 29,281,392 V43E possibly damaging Het
Fat1 C A 8: 44,950,348 H45Q probably benign Het
Fbxw16 A T 9: 109,432,482 C439S probably benign Het
Gba2 A T 4: 43,570,832 F280Y probably damaging Het
Gfm1 A G 3: 67,457,918 I517V probably benign Het
Gng13 C T 17: 25,718,722 Q8* probably null Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gphn A T 12: 78,590,659 I381F probably damaging Het
Grm3 T C 5: 9,504,794 N833D probably damaging Het
Gstt2 G T 10: 75,832,432 T163K probably damaging Het
Gusb A T 5: 129,998,086 V388E probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hspg2 A G 4: 137,515,423 T650A possibly damaging Het
Ints2 C T 11: 86,248,851 V306I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Klhl18 A T 9: 110,428,681 C564S probably benign Het
Krt40 T A 11: 99,541,714 R159* probably null Het
L3mbtl4 G A 17: 68,455,780 V103M probably damaging Het
Lnx2 C A 5: 147,019,040 V649L possibly damaging Het
Lpp A T 16: 24,608,241 Q39H probably damaging Het
Lrpprc A T 17: 84,753,112 probably null Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Mbtps2 G T X: 157,568,368 T134K probably benign Het
Mfng C T 15: 78,764,437 V147M possibly damaging Het
Mks1 T C 11: 87,857,928 S273P probably benign Het
Myh2 T C 11: 67,180,821 L488P probably damaging Het
Myo15 A G 11: 60,478,538 N708S probably benign Het
Myo6 A T 9: 80,292,466 N1019I probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Ncoa1 T G 12: 4,295,976 N457T probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nlrp4e C A 7: 23,355,203 N927K probably damaging Het
Npffr2 T C 5: 89,582,754 M181T probably benign Het
Nxf7 A T X: 135,584,383 C495S possibly damaging Het
Oas1g T C 5: 120,887,529 T12A probably benign Het
Olfr130 C G 17: 38,067,671 R167G possibly damaging Het
Olfr23 T A 11: 73,941,053 V269E probably benign Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Olfr591 A T 7: 103,173,283 V118E possibly damaging Het
Olfr744 T A 14: 50,618,579 L119Q probably damaging Het
Papln C T 12: 83,783,379 Q1008* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Phf2 T A 13: 48,804,489 E1016D unknown Het
Phf8 T A X: 151,552,622 D197E probably benign Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Prpf4 A G 4: 62,422,605 Y419C probably damaging Het
Prr15l C A 11: 96,934,614 Y23* probably null Het
Prr5 T A 15: 84,702,951 S301T probably benign Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Radil A G 5: 142,543,471 F186L probably damaging Het
Reg3g A T 6: 78,468,561 M1K probably null Het
Rps6ka3 A G X: 159,317,967 Y76C probably damaging Het
Rtl1 C T 12: 109,590,363 V1681I possibly damaging Het
Sfmbt1 C T 14: 30,811,507 R614C probably damaging Het
Slc12a4 A G 8: 105,951,967 S244P probably benign Het
Sptbn1 T C 11: 30,139,250 T671A possibly damaging Het
Supt16 A T 14: 52,174,113 N604K probably damaging Het
Synj2 G A 17: 6,029,783 V1096I probably benign Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tbc1d25 T C X: 8,172,869 Y140C probably damaging Het
Tdrd7 A G 4: 46,016,987 D709G probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tgfbi C A 13: 56,629,702 T333N probably benign Het
Tnk1 T C 11: 69,855,682 Y235C probably damaging Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Unc13a A G 8: 71,658,032 F464L probably benign Het
Usp17le C A 7: 104,768,460 A492S probably damaging Het
Vmn1r213 A T 13: 23,011,762 M172L probably benign Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r19 A T 6: 123,335,986 I672F possibly damaging Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Xdh T A 17: 73,898,362 H1036L probably damaging Het
Zfp930 T A 8: 69,228,296 Y214* probably null Het
Other mutations in Fasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fasn APN 11 120820539 missense probably damaging 1.00
IGL01014:Fasn APN 11 120817229 missense probably damaging 0.99
IGL01131:Fasn APN 11 120814619 missense probably benign 0.01
IGL01603:Fasn APN 11 120816065 missense probably damaging 0.99
IGL01606:Fasn APN 11 120809023 critical splice donor site probably null
IGL01897:Fasn APN 11 120807939 missense probably damaging 1.00
IGL01899:Fasn APN 11 120820149 splice site probably benign
IGL01987:Fasn APN 11 120818073 missense probably damaging 1.00
IGL02103:Fasn APN 11 120811936 missense probably damaging 1.00
IGL02212:Fasn APN 11 120807903 missense probably damaging 1.00
IGL02294:Fasn APN 11 120810276 missense probably damaging 0.98
IGL02336:Fasn APN 11 120813736 missense possibly damaging 0.48
IGL02417:Fasn APN 11 120820340 missense probably damaging 1.00
IGL02452:Fasn APN 11 120808180 missense probably benign 0.00
IGL02559:Fasn APN 11 120809066 missense possibly damaging 0.51
IGL02724:Fasn APN 11 120809833 missense probably benign 0.41
IGL02862:Fasn APN 11 120818979 missense possibly damaging 0.89
IGL02947:Fasn APN 11 120815676 missense probably damaging 0.99
IGL03025:Fasn APN 11 120818148 missense probably benign 0.01
IGL03131:Fasn APN 11 120810724 missense possibly damaging 0.93
IGL03157:Fasn APN 11 120807909 missense probably benign 0.12
IGL03182:Fasn APN 11 120812726 missense probably damaging 1.00
IGL03370:Fasn APN 11 120812795 missense possibly damaging 0.95
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0019:Fasn UTSW 11 120807998 splice site probably benign
R0243:Fasn UTSW 11 120815315 missense probably benign 0.00
R0304:Fasn UTSW 11 120819936 missense possibly damaging 0.85
R0449:Fasn UTSW 11 120811068 missense probably benign
R0626:Fasn UTSW 11 120811925 missense probably damaging 0.99
R1037:Fasn UTSW 11 120809451 missense probably benign
R1061:Fasn UTSW 11 120822182 unclassified probably null
R1109:Fasn UTSW 11 120812324 missense possibly damaging 0.77
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1467:Fasn UTSW 11 120811040 missense probably benign 0.07
R1498:Fasn UTSW 11 120815419 missense probably damaging 0.98
R1552:Fasn UTSW 11 120818558 missense probably damaging 1.00
R1568:Fasn UTSW 11 120813249 missense possibly damaging 0.78
R1624:Fasn UTSW 11 120813111 missense probably damaging 1.00
R1774:Fasn UTSW 11 120817171 missense probably damaging 1.00
R1826:Fasn UTSW 11 120808499 splice site probably benign
R1846:Fasn UTSW 11 120813307 missense probably benign 0.00
R2298:Fasn UTSW 11 120813816 missense possibly damaging 0.78
R2513:Fasn UTSW 11 120814748 missense probably damaging 1.00
R3001:Fasn UTSW 11 120809845 missense probably benign
R3002:Fasn UTSW 11 120809845 missense probably benign
R3154:Fasn UTSW 11 120807939 missense probably damaging 1.00
R3434:Fasn UTSW 11 120822773 missense probably damaging 0.99
R4794:Fasn UTSW 11 120811295 missense probably benign 0.36
R4840:Fasn UTSW 11 120813059 missense possibly damaging 0.83
R4863:Fasn UTSW 11 120808828 missense probably damaging 1.00
R4876:Fasn UTSW 11 120812312 missense probably damaging 1.00
R4914:Fasn UTSW 11 120816646 missense probably benign 0.39
R4915:Fasn UTSW 11 120816646 missense probably benign 0.39
R4916:Fasn UTSW 11 120816646 missense probably benign 0.39
R4918:Fasn UTSW 11 120816646 missense probably benign 0.39
R4936:Fasn UTSW 11 120816085 missense probably damaging 1.00
R5025:Fasn UTSW 11 120811908 missense probably benign 0.00
R5092:Fasn UTSW 11 120815036 missense probably benign 0.00
R5120:Fasn UTSW 11 120811391 missense probably benign 0.22
R5175:Fasn UTSW 11 120816369 missense probably benign 0.14
R5183:Fasn UTSW 11 120808882 missense probably benign 0.44
R5506:Fasn UTSW 11 120809510 missense probably benign 0.26
R5557:Fasn UTSW 11 120812426 missense probably benign 0.10
R5614:Fasn UTSW 11 120813328 missense probably benign
R5728:Fasn UTSW 11 120813513 missense probably benign 0.06
R5838:Fasn UTSW 11 120816124 missense probably damaging 0.98
R5959:Fasn UTSW 11 120808564 missense probably damaging 0.99
R6029:Fasn UTSW 11 120820909 missense probably damaging 1.00
R6134:Fasn UTSW 11 120822186 missense probably benign 0.05
R6335:Fasn UTSW 11 120815359 missense probably damaging 0.96
R6452:Fasn UTSW 11 120815411 missense probably damaging 1.00
R6627:Fasn UTSW 11 120818927 missense probably benign 0.10
R6742:Fasn UTSW 11 120810453 missense probably damaging 0.96
R6767:Fasn UTSW 11 120817487 missense possibly damaging 0.62
R6927:Fasn UTSW 11 120808289 missense probably benign 0.03
R6976:Fasn UTSW 11 120819867 missense probably damaging 1.00
R7092:Fasn UTSW 11 120820120 missense possibly damaging 0.56
R7157:Fasn UTSW 11 120810465 nonsense probably null
R7373:Fasn UTSW 11 120813976 missense possibly damaging 0.81
X0067:Fasn UTSW 11 120816303 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGCATGACAATCAATCTCCGCAG -3'
(R):5'- CACATCAAGTGGGACCACAGTCAG -3'

Sequencing Primer
(F):5'- CAATCTCCGCAGCCCCC -3'
(R):5'- CCACAGTCAGACTTGGGATG -3'
Posted On2013-04-24