Mutagenetix > Incidental Mutation

Incidental Mutation 'R0389:Pikfyve'

31442

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

MMRRC Submission

038595-MU

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0389 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65196706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 179 (H179R)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000185263] [ENSMUST00000190058]

AlphaFold

Q9Z1T6

Predicted Effect

probably damaging
Transcript: ENSMUST00000081154
AA Change: H190R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: H190R

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097707
AA Change: H179R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: H179R

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185263

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185317

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186404

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188799

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189925

Predicted Effect

probably benign
Transcript: ENSMUST00000190058

SMART Domains

Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190847

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213081

Meta Mutation Damage Score

0.9326

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.9%
20x: 91.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 104 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432M17Rik	G	A	3: 121,671,404	E30K	unknown	Het
Abi3bp	A	T	16: 56,671,307	T1319S	possibly damaging	Het
Adam18	T	C	8: 24,629,637		probably null	Het
Adgre1	G	A	17: 57,406,839	D175N	possibly damaging	Het
Adgrf1	T	C	17: 43,303,788		probably null	Het
Ankhd1	A	G	18: 36,644,599	S1612G	possibly damaging	Het
Anks1	A	G	17: 27,995,952	R458G	possibly damaging	Het
C130026I21Rik	T	A	1: 85,270,052	N5Y	probably benign	Het
Cacna1g	C	T	11: 94,459,697	V441M	probably damaging	Het
Cadps2	A	T	6: 23,321,782	V1037E	possibly damaging	Het
Casz1	T	C	4: 148,948,911	V1380A	possibly damaging	Het
Cenpq	T	C	17: 40,933,194		probably benign	Het
Chrac1	T	C	15: 73,093,527	I93T	possibly damaging	Het
Cntnap2	T	A	6: 46,009,637	S359T	probably benign	Het
Col6a6	C	A	9: 105,784,204	M235I	probably benign	Het
Crat	T	C	2: 30,403,628		probably benign	Het
Cyp1a2	T	C	9: 57,682,025	N169D	probably benign	Het
Dennd1c	T	A	17: 57,067,649	T499S	probably benign	Het
Dst	A	G	1: 34,294,550		probably null	Het
Dync2h1	G	T	9: 7,167,244		probably null	Het
Eif3h	C	A	15: 51,799,264	V129F	probably damaging	Het
Eno2	A	G	6: 124,762,691	F380L	probably damaging	Het
Ergic2	T	A	6: 148,183,202	I34F	probably benign	Het
Ergic3	G	A	2: 156,016,787	V278M	probably benign	Het
Fam185a	C	T	5: 21,459,285	T339M	probably damaging	Het
Fam20b	A	T	1: 156,681,453	D396E	probably benign	Het
Fam71f2	T	A	6: 29,281,392	V43E	possibly damaging	Het
Fasn	G	T	11: 120,816,182	D881E	probably damaging	Het
Fat1	C	A	8: 44,950,348	H45Q	probably benign	Het
Fbxw16	A	T	9: 109,432,482	C439S	probably benign	Het
Gba2	A	T	4: 43,570,832	F280Y	probably damaging	Het
Gfm1	A	G	3: 67,457,918	I517V	probably benign	Het
Gng13	C	T	17: 25,718,722	Q8*	probably null	Het
Golga1	A	T	2: 39,018,441	S749T	probably damaging	Het
Gphn	A	T	12: 78,590,659	I381F	probably damaging	Het
Grm3	T	C	5: 9,504,794	N833D	probably damaging	Het
Gstt2	G	T	10: 75,832,432	T163K	probably damaging	Het
Gusb	A	T	5: 129,998,086	V388E	probably damaging	Het
Hcrtr2	A	T	9: 76,246,380	Y243*	probably null	Het
Hspg2	A	G	4: 137,515,423	T650A	possibly damaging	Het
Ints2	C	T	11: 86,248,851	V306I	probably damaging	Het
Itga1	T	A	13: 114,992,460	D554V	probably benign	Het
Itgam	C	T	7: 128,081,634	A245V	probably damaging	Het
Kcnk15	A	G	2: 163,858,323	T161A	probably benign	Het
Klhl18	A	T	9: 110,428,681	C564S	probably benign	Het
Krt40	T	A	11: 99,541,714	R159*	probably null	Het
L3mbtl4	G	A	17: 68,455,780	V103M	probably damaging	Het
Lnx2	C	A	5: 147,019,040	V649L	possibly damaging	Het
Lpp	A	T	16: 24,608,241	Q39H	probably damaging	Het
Lrpprc	A	T	17: 84,753,112		probably null	Het
Map3k19	A	T	1: 127,822,415	N1066K	probably benign	Het
Mbtps2	G	T	X: 157,568,368	T134K	probably benign	Het
Mfng	C	T	15: 78,764,437	V147M	possibly damaging	Het
Mks1	T	C	11: 87,857,928	S273P	probably benign	Het
Myh2	T	C	11: 67,180,821	L488P	probably damaging	Het
Myo15	A	G	11: 60,478,538	N708S	probably benign	Het
Myo6	A	T	9: 80,292,466	N1019I	probably damaging	Het
Myrf	G	C	19: 10,218,162	T428S	probably benign	Het
Ncoa1	T	G	12: 4,295,976	N457T	probably benign	Het
Neb	T	C	2: 52,161,477		probably null	Het
Nlrp4e	C	A	7: 23,355,203	N927K	probably damaging	Het
Npffr2	T	C	5: 89,582,754	M181T	probably benign	Het
Nxf7	A	T	X: 135,584,383	C495S	possibly damaging	Het
Oas1g	T	C	5: 120,887,529	T12A	probably benign	Het
Olfr130	C	G	17: 38,067,671	R167G	possibly damaging	Het
Olfr23	T	A	11: 73,941,053	V269E	probably benign	Het
Olfr484	A	G	7: 108,124,816	V149A	probably benign	Het
Olfr591	A	T	7: 103,173,283	V118E	possibly damaging	Het
Olfr744	T	A	14: 50,618,579	L119Q	probably damaging	Het
Papln	C	T	12: 83,783,379	Q1008*	probably null	Het
Pcdhb10	A	C	18: 37,412,432	D187A	probably damaging	Het
Phf2	T	A	13: 48,804,489	E1016D	unknown	Het
Phf8	T	A	X: 151,552,622	D197E	probably benign	Het
Prkcz	T	A	4: 155,269,140	D250V	probably damaging	Het
Prpf4	A	G	4: 62,422,605	Y419C	probably damaging	Het
Prr15l	C	A	11: 96,934,614	Y23*	probably null	Het
Prr5	T	A	15: 84,702,951	S301T	probably benign	Het
Psg16	T	A	7: 17,095,163	I224N	probably benign	Het
Radil	A	G	5: 142,543,471	F186L	probably damaging	Het
Reg3g	A	T	6: 78,468,561	M1K	probably null	Het
Rps6ka3	A	G	X: 159,317,967	Y76C	probably damaging	Het
Rtl1	C	T	12: 109,590,363	V1681I	possibly damaging	Het
Sfmbt1	C	T	14: 30,811,507	R614C	probably damaging	Het
Slc12a4	A	G	8: 105,951,967	S244P	probably benign	Het
Sptbn1	T	C	11: 30,139,250	T671A	possibly damaging	Het
Supt16	A	T	14: 52,174,113	N604K	probably damaging	Het
Synj2	G	A	17: 6,029,783	V1096I	probably benign	Het
Tas2r129	G	T	6: 132,951,196	C32F	probably benign	Het
Tbc1d25	T	C	X: 8,172,869	Y140C	probably damaging	Het
Tdrd7	A	G	4: 46,016,987	D709G	probably benign	Het
Tfap2d	C	T	1: 19,104,367	R15C	possibly damaging	Het
Tgfbi	C	A	13: 56,629,702	T333N	probably benign	Het
Tnk1	T	C	11: 69,855,682	Y235C	probably damaging	Het
Ttc17	A	G	2: 94,378,094	F144S	probably benign	Het
Twnk	G	T	19: 45,008,139	G337V	possibly damaging	Het
Unc13a	A	G	8: 71,658,032	F464L	probably benign	Het
Usp17le	C	A	7: 104,768,460	A492S	probably damaging	Het
Vmn1r213	A	T	13: 23,011,762	M172L	probably benign	Het
Vmn1r71	G	A	7: 10,748,311	T84I	probably benign	Het
Vmn2r109	C	T	17: 20,541,074	V674M	probably damaging	Het
Vmn2r19	A	T	6: 123,335,986	I672F	possibly damaging	Het
Vmn2r77	T	C	7: 86,801,494	V196A	probably benign	Het
Xdh	T	A	17: 73,898,362	H1036L	probably damaging	Het
Zfp930	T	A	8: 69,228,296	Y214*	probably null	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65272571	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9605:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCACATTGCTTTTAGATAGCCCTTCTT -3'
(R):5'- CCCCAGTCACTGCATAAATCCATTCC -3'

Sequencing Primer
(F):5'- ctttcttctctctctctctctctc -3'
(R):5'- ATGGTTCAGTGTCCATAAACTCTCTC -3'

Posted On

2013-04-24