Incidental Mutation 'R0389:L3mbtl4'
Institutional Source Beutler Lab
Gene Symbol L3mbtl4
Ensembl Gene ENSMUSG00000041565
Gene NameL3MBTL4 histone methyl-lysine binding protein
MMRRC Submission 038595-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0389 (G1)
Quality Score225
Status Not validated
Chromosomal Location68273797-68777961 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68455780 bp
Amino Acid Change Valine to Methionine at position 103 (V103M)
Ref Sequence ENSEMBL: ENSMUSP00000117626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093007] [ENSMUST00000124543] [ENSMUST00000139383]
Predicted Effect probably damaging
Transcript: ENSMUST00000093007
AA Change: V103M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094892
Gene: ENSMUSG00000041565
AA Change: V103M

MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
MBT 269 364 2.8e-47 SMART
Pfam:zf-C2HC 378 407 8.1e-16 PFAM
SAM 540 607 5.17e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124543
AA Change: V103M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121045
Gene: ENSMUSG00000041565
AA Change: V103M

MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
MBT 269 364 2.8e-47 SMART
Pfam:zf-C2HC 376 407 3.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139383
AA Change: V103M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117626
Gene: ENSMUSG00000041565
AA Change: V103M

MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150573
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik G A 3: 121,671,404 E30K unknown Het
Abi3bp A T 16: 56,671,307 T1319S possibly damaging Het
Adam18 T C 8: 24,629,637 probably null Het
Adgre1 G A 17: 57,406,839 D175N possibly damaging Het
Adgrf1 T C 17: 43,303,788 probably null Het
Ankhd1 A G 18: 36,644,599 S1612G possibly damaging Het
Anks1 A G 17: 27,995,952 R458G possibly damaging Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1g C T 11: 94,459,697 V441M probably damaging Het
Cadps2 A T 6: 23,321,782 V1037E possibly damaging Het
Casz1 T C 4: 148,948,911 V1380A possibly damaging Het
Cenpq T C 17: 40,933,194 probably benign Het
Chrac1 T C 15: 73,093,527 I93T possibly damaging Het
Cntnap2 T A 6: 46,009,637 S359T probably benign Het
Col6a6 C A 9: 105,784,204 M235I probably benign Het
Crat T C 2: 30,403,628 probably benign Het
Cyp1a2 T C 9: 57,682,025 N169D probably benign Het
Dennd1c T A 17: 57,067,649 T499S probably benign Het
Dst A G 1: 34,294,550 probably null Het
Dync2h1 G T 9: 7,167,244 probably null Het
Eif3h C A 15: 51,799,264 V129F probably damaging Het
Eno2 A G 6: 124,762,691 F380L probably damaging Het
Ergic2 T A 6: 148,183,202 I34F probably benign Het
Ergic3 G A 2: 156,016,787 V278M probably benign Het
Fam185a C T 5: 21,459,285 T339M probably damaging Het
Fam20b A T 1: 156,681,453 D396E probably benign Het
Fam71f2 T A 6: 29,281,392 V43E possibly damaging Het
Fasn G T 11: 120,816,182 D881E probably damaging Het
Fat1 C A 8: 44,950,348 H45Q probably benign Het
Fbxw16 A T 9: 109,432,482 C439S probably benign Het
Gba2 A T 4: 43,570,832 F280Y probably damaging Het
Gfm1 A G 3: 67,457,918 I517V probably benign Het
Gng13 C T 17: 25,718,722 Q8* probably null Het
Golga1 A T 2: 39,018,441 S749T probably damaging Het
Gphn A T 12: 78,590,659 I381F probably damaging Het
Grm3 T C 5: 9,504,794 N833D probably damaging Het
Gstt2 G T 10: 75,832,432 T163K probably damaging Het
Gusb A T 5: 129,998,086 V388E probably damaging Het
Hcrtr2 A T 9: 76,246,380 Y243* probably null Het
Hspg2 A G 4: 137,515,423 T650A possibly damaging Het
Ints2 C T 11: 86,248,851 V306I probably damaging Het
Itga1 T A 13: 114,992,460 D554V probably benign Het
Itgam C T 7: 128,081,634 A245V probably damaging Het
Kcnk15 A G 2: 163,858,323 T161A probably benign Het
Klhl18 A T 9: 110,428,681 C564S probably benign Het
Krt40 T A 11: 99,541,714 R159* probably null Het
Lnx2 C A 5: 147,019,040 V649L possibly damaging Het
Lpp A T 16: 24,608,241 Q39H probably damaging Het
Lrpprc A T 17: 84,753,112 probably null Het
Map3k19 A T 1: 127,822,415 N1066K probably benign Het
Mbtps2 G T X: 157,568,368 T134K probably benign Het
Mfng C T 15: 78,764,437 V147M possibly damaging Het
Mks1 T C 11: 87,857,928 S273P probably benign Het
Myh2 T C 11: 67,180,821 L488P probably damaging Het
Myo15 A G 11: 60,478,538 N708S probably benign Het
Myo6 A T 9: 80,292,466 N1019I probably damaging Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Ncoa1 T G 12: 4,295,976 N457T probably benign Het
Neb T C 2: 52,161,477 probably null Het
Nlrp4e C A 7: 23,355,203 N927K probably damaging Het
Npffr2 T C 5: 89,582,754 M181T probably benign Het
Nxf7 A T X: 135,584,383 C495S possibly damaging Het
Oas1g T C 5: 120,887,529 T12A probably benign Het
Olfr130 C G 17: 38,067,671 R167G possibly damaging Het
Olfr23 T A 11: 73,941,053 V269E probably benign Het
Olfr484 A G 7: 108,124,816 V149A probably benign Het
Olfr591 A T 7: 103,173,283 V118E possibly damaging Het
Olfr744 T A 14: 50,618,579 L119Q probably damaging Het
Papln C T 12: 83,783,379 Q1008* probably null Het
Pcdhb10 A C 18: 37,412,432 D187A probably damaging Het
Phf2 T A 13: 48,804,489 E1016D unknown Het
Phf8 T A X: 151,552,622 D197E probably benign Het
Pikfyve A G 1: 65,196,706 H179R probably damaging Het
Prkcz T A 4: 155,269,140 D250V probably damaging Het
Prpf4 A G 4: 62,422,605 Y419C probably damaging Het
Prr15l C A 11: 96,934,614 Y23* probably null Het
Prr5 T A 15: 84,702,951 S301T probably benign Het
Psg16 T A 7: 17,095,163 I224N probably benign Het
Radil A G 5: 142,543,471 F186L probably damaging Het
Reg3g A T 6: 78,468,561 M1K probably null Het
Rps6ka3 A G X: 159,317,967 Y76C probably damaging Het
Rtl1 C T 12: 109,590,363 V1681I possibly damaging Het
Sfmbt1 C T 14: 30,811,507 R614C probably damaging Het
Slc12a4 A G 8: 105,951,967 S244P probably benign Het
Sptbn1 T C 11: 30,139,250 T671A possibly damaging Het
Supt16 A T 14: 52,174,113 N604K probably damaging Het
Synj2 G A 17: 6,029,783 V1096I probably benign Het
Tas2r129 G T 6: 132,951,196 C32F probably benign Het
Tbc1d25 T C X: 8,172,869 Y140C probably damaging Het
Tdrd7 A G 4: 46,016,987 D709G probably benign Het
Tfap2d C T 1: 19,104,367 R15C possibly damaging Het
Tgfbi C A 13: 56,629,702 T333N probably benign Het
Tnk1 T C 11: 69,855,682 Y235C probably damaging Het
Ttc17 A G 2: 94,378,094 F144S probably benign Het
Twnk G T 19: 45,008,139 G337V possibly damaging Het
Unc13a A G 8: 71,658,032 F464L probably benign Het
Usp17le C A 7: 104,768,460 A492S probably damaging Het
Vmn1r213 A T 13: 23,011,762 M172L probably benign Het
Vmn1r71 G A 7: 10,748,311 T84I probably benign Het
Vmn2r109 C T 17: 20,541,074 V674M probably damaging Het
Vmn2r19 A T 6: 123,335,986 I672F possibly damaging Het
Vmn2r77 T C 7: 86,801,494 V196A probably benign Het
Xdh T A 17: 73,898,362 H1036L probably damaging Het
Zfp930 T A 8: 69,228,296 Y214* probably null Het
Other mutations in L3mbtl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:L3mbtl4 APN 17 68630202 missense probably damaging 1.00
IGL02274:L3mbtl4 APN 17 68764584 missense probably benign 0.01
IGL02304:L3mbtl4 APN 17 68587185 nonsense probably null
IGL02473:L3mbtl4 APN 17 68559777 missense possibly damaging 0.93
IGL02543:L3mbtl4 APN 17 68461612 splice site probably benign
IGL02706:L3mbtl4 APN 17 68486919 missense probably damaging 1.00
IGL02729:L3mbtl4 APN 17 68484743 missense probably benign 0.23
IGL02817:L3mbtl4 APN 17 68630254 missense probably benign 0.30
IGL03237:L3mbtl4 APN 17 68777861 missense probably damaging 1.00
IGL03371:L3mbtl4 APN 17 68461568 missense probably damaging 1.00
R0092:L3mbtl4 UTSW 17 68425703 missense probably benign 0.01
R0504:L3mbtl4 UTSW 17 68777912 missense probably benign 0.07
R0598:L3mbtl4 UTSW 17 68459773 missense probably benign 0.04
R0650:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0652:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0842:L3mbtl4 UTSW 17 68486962 missense probably benign 0.19
R1900:L3mbtl4 UTSW 17 68459805 missense probably damaging 0.99
R2065:L3mbtl4 UTSW 17 68425692 missense probably benign 0.04
R2173:L3mbtl4 UTSW 17 68587193 missense probably damaging 1.00
R2987:L3mbtl4 UTSW 17 68359518 missense possibly damaging 0.89
R3119:L3mbtl4 UTSW 17 68425674 missense probably benign 0.02
R3153:L3mbtl4 UTSW 17 68457248 nonsense probably null
R4044:L3mbtl4 UTSW 17 68777914 missense possibly damaging 0.63
R4579:L3mbtl4 UTSW 17 68764640 missense probably benign
R4717:L3mbtl4 UTSW 17 68455713 missense probably null 0.67
R4798:L3mbtl4 UTSW 17 68359480 start codon destroyed probably null 0.03
R4831:L3mbtl4 UTSW 17 68461563 missense probably damaging 0.98
R4852:L3mbtl4 UTSW 17 68559753 missense probably damaging 1.00
R5226:L3mbtl4 UTSW 17 68764722 critical splice donor site probably null
R5402:L3mbtl4 UTSW 17 68455774 missense probably damaging 1.00
R5604:L3mbtl4 UTSW 17 68777922 missense probably benign 0.01
R6377:L3mbtl4 UTSW 17 68777923 missense probably benign 0.04
R6708:L3mbtl4 UTSW 17 68630258 missense probably benign 0.19
R6853:L3mbtl4 UTSW 17 68777920 missense probably damaging 0.97
R6905:L3mbtl4 UTSW 17 68777888 missense probably benign 0.05
R7018:L3mbtl4 UTSW 17 68486943 missense probably damaging 1.00
R7045:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7047:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7049:L3mbtl4 UTSW 17 68461566 missense probably benign 0.00
R7419:L3mbtl4 UTSW 17 68641542 missense probably benign 0.28
R8271:L3mbtl4 UTSW 17 68486943 missense probably damaging 1.00
R8493:L3mbtl4 UTSW 17 68630244 missense probably damaging 1.00
X0063:L3mbtl4 UTSW 17 68630253 missense probably benign 0.37
Z1176:L3mbtl4 UTSW 17 68425687 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gtatcttcttttgcccctcatc -3'
Posted On2013-04-24