Incidental Mutation 'R7337:Vmn1r52'
ID569573
Institutional Source Beutler Lab
Gene Symbol Vmn1r52
Ensembl Gene ENSMUSG00000060816
Gene Namevomeronasal 1 receptor 52
SynonymsV1ra7, VN3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7337 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location90174808-90181248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90179623 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 303 (M303K)
Ref Sequence ENSEMBL: ENSMUSP00000078760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079832] [ENSMUST00000226520] [ENSMUST00000227100] [ENSMUST00000227578] [ENSMUST00000227893] [ENSMUST00000228385] [ENSMUST00000228394] [ENSMUST00000228665]
Predicted Effect probably benign
Transcript: ENSMUST00000079832
AA Change: M303K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078760
Gene: ENSMUSG00000060816
AA Change: M303K

DomainStartEndE-ValueType
Pfam:V1R 38 302 1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226520
AA Change: M303K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227100
AA Change: M103K

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227578
AA Change: M124K

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000227893
AA Change: M303K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably damaging
Transcript: ENSMUST00000228385
AA Change: M115K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000228394
AA Change: M303K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000228665
AA Change: M303K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik A G 14: 49,234,491 M163T possibly damaging Het
Abcb11 A T 2: 69,245,769 H1198Q probably damaging Het
Adamts14 A G 10: 61,207,460 V743A probably damaging Het
Adgrg6 A G 10: 14,467,351 V284A possibly damaging Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Alb A G 5: 90,474,593 K560R probably damaging Het
Aqp9 A T 9: 71,162,482 F8L probably benign Het
Arhgef7 T C 8: 11,785,789 L182P probably damaging Het
Atr A G 9: 95,871,448 D701G probably damaging Het
Calr3 C T 8: 72,431,495 D187N probably damaging Het
Ccdc65 A G 15: 98,721,096 T319A probably benign Het
Ccdc66 A T 14: 27,500,333 L151H probably damaging Het
Ces2e T A 8: 104,931,056 probably null Het
Cfap46 A G 7: 139,630,576 probably null Het
Cfap74 A G 4: 155,460,015 T1034A unknown Het
Cldnd1 T G 16: 58,728,959 probably null Het
Clec4f C A 6: 83,653,208 V123L probably benign Het
Cntn6 C T 6: 104,650,530 T108I probably damaging Het
Crygn T G 5: 24,756,149 D53A possibly damaging Het
Cyp27a1 T A 1: 74,735,435 V204E probably damaging Het
Cyp2c67 A T 19: 39,609,264 probably null Het
Ddb1 T C 19: 10,627,831 V1061A possibly damaging Het
Dnah12 G T 14: 26,766,577 probably null Het
Draxin T C 4: 148,112,759 T194A probably benign Het
Drosha T A 15: 12,846,199 D473E possibly damaging Het
G6pd2 T A 5: 61,810,219 C446S probably benign Het
Gm29106 C T 1: 118,176,912 S3L unknown Het
Grin3a T C 4: 49,702,762 Y908C probably damaging Het
Ints2 G A 11: 86,217,842 A893V probably benign Het
Ippk C T 13: 49,449,291 T371I probably benign Het
Irf2 T A 8: 46,807,281 C83S probably damaging Het
Jph3 C T 8: 121,753,702 A373V probably benign Het
Kcnj6 C T 16: 94,833,214 V13I probably benign Het
Lama3 T C 18: 12,507,040 probably null Het
Lmo7 A T 14: 101,884,204 Q235L probably damaging Het
March7 A G 2: 60,240,845 probably null Het
Mfsd6l A T 11: 68,557,283 Y320F possibly damaging Het
Mroh1 T A 15: 76,451,476 W1440R probably benign Het
Mrps17 G A 5: 129,716,799 G19D probably damaging Het
Myt1 A G 2: 181,802,963 H566R possibly damaging Het
Nav2 T C 7: 49,551,773 L176P possibly damaging Het
Nop58 T A 1: 59,698,440 C139S probably benign Het
Nsd1 A G 13: 55,246,209 D644G probably damaging Het
Nsd2 T A 5: 33,885,472 C1027S probably damaging Het
Nsmce2 A G 15: 59,601,416 I235V probably damaging Het
Nyap2 T C 1: 81,336,515 V642A possibly damaging Het
Olfr300-ps1 A T 7: 86,443,120 L46F unknown Het
Olfr919 A G 9: 38,697,865 V167A probably benign Het
Paqr7 A G 4: 134,507,120 D96G probably benign Het
Parp4 A G 14: 56,602,395 Y520C probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Piezo1 A T 8: 122,485,724 Y1955N Het
Pnmal1 A G 7: 16,961,390 K390R probably benign Het
Prdm10 G T 9: 31,316,241 Q47H probably damaging Het
Psg22 T A 7: 18,719,574 F104I probably benign Het
Ptprf T C 4: 118,211,125 E1738G probably damaging Het
Rad21l A T 2: 151,658,445 L218Q probably damaging Het
Rad54l2 A G 9: 106,705,825 I798T probably damaging Het
Rgs5 G T 1: 169,655,580 M1I probably null Het
Rhbdl2 T C 4: 123,817,866 V132A possibly damaging Het
Rmi1 T A 13: 58,409,579 Y547* probably null Het
Rptn A T 3: 93,396,905 D515V probably benign Het
Rsph10b A G 5: 143,961,215 N505D probably benign Het
Samhd1 T C 2: 157,106,244 D539G probably damaging Het
Scube3 A T 17: 28,168,182 I885F probably damaging Het
Sfmbt1 A G 14: 30,784,739 I247V possibly damaging Het
Slc25a21 T C 12: 56,858,043 I62V probably benign Het
Slc4a11 T A 2: 130,685,532 N648Y probably damaging Het
Slc7a11 A G 3: 50,442,999 V88A possibly damaging Het
Slc7a8 A C 14: 54,726,806 F397V possibly damaging Het
Sox12 A C 2: 152,397,457 L81R probably damaging Het
Spg11 T C 2: 122,084,993 I1057V probably benign Het
St8sia3 G A 18: 64,269,916 V265I probably benign Het
Stxbp5 A G 10: 9,809,130 S509P possibly damaging Het
Svep1 T C 4: 58,108,323 Y1129C probably damaging Het
Tenm4 G T 7: 96,874,126 R1625L probably benign Het
Tlr4 T C 4: 66,839,954 F328S possibly damaging Het
Tmprss15 T C 16: 79,071,276 T215A probably benign Het
Tmprss9 A T 10: 80,882,670 I62L probably benign Het
Trpm5 C T 7: 143,089,019 A64T probably benign Het
Txk A C 5: 72,731,766 Y148* probably null Het
Uba5 C T 9: 104,055,255 G170R possibly damaging Het
Uggt2 A T 14: 119,086,175 D231E probably benign Het
Ulk4 A T 9: 121,248,927 D525E probably benign Het
Vmn1r158 T A 7: 22,790,224 T187S probably benign Het
Vmn2r54 A G 7: 12,622,117 F454S probably benign Het
Zbp1 A T 2: 173,218,753 L8* probably null Het
Zmym2 A T 14: 56,944,100 D924V probably benign Het
Other mutations in Vmn1r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Vmn1r52 APN 6 90178923 missense probably benign
IGL02102:Vmn1r52 APN 6 90179207 missense possibly damaging 0.92
IGL02583:Vmn1r52 APN 6 90179144 nonsense probably null
IGL02938:Vmn1r52 APN 6 90179313 missense possibly damaging 0.58
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0233:Vmn1r52 UTSW 6 90179611 missense possibly damaging 0.96
R0904:Vmn1r52 UTSW 6 90179464 missense probably damaging 0.98
R2190:Vmn1r52 UTSW 6 90179169 missense probably benign 0.12
R4184:Vmn1r52 UTSW 6 90179237 missense probably benign 0.00
R4906:Vmn1r52 UTSW 6 90178948 missense possibly damaging 0.63
R5475:Vmn1r52 UTSW 6 90178912 missense probably benign 0.04
R5689:Vmn1r52 UTSW 6 90179250 missense possibly damaging 0.95
R5740:Vmn1r52 UTSW 6 90179194 missense probably benign 0.02
R7263:Vmn1r52 UTSW 6 90179553 missense probably benign 0.00
R7374:Vmn1r52 UTSW 6 90179136 missense probably benign 0.08
R8161:Vmn1r52 UTSW 6 90179257 missense possibly damaging 0.73
R8699:Vmn1r52 UTSW 6 90178760 missense probably benign 0.02
R8747:Vmn1r52 UTSW 6 90179469 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GAGCTTCTTTCTGCTGATGTCAAC -3'
(R):5'- GACAAGCCTGATCACCTTTCAG -3'

Sequencing Primer
(F):5'- TCAACATTTGACAGCATCATCTC -3'
(R):5'- CACCTTTCAGATTTTCTCAGAAGAG -3'
Posted On2019-09-13