Incidental Mutation 'R4239:Prl7a1'
ID321280
Institutional Source Beutler Lab
Gene Symbol Prl7a1
Ensembl Gene ENSMUSG00000006488
Gene Nameprolactin family 7, subfamily a, member 1
SynonymsPLP-G, Prlpg, Prlpe, PLP-E
MMRRC Submission 041056-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4239 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location27633366-27642493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27637566 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 129 (Q129L)
Ref Sequence ENSEMBL: ENSMUSP00000093614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006659] [ENSMUST00000095924] [ENSMUST00000224852]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006659
AA Change: Q128L

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006659
Gene: ENSMUSG00000006488
AA Change: Q128L

DomainStartEndE-ValueType
Pfam:Hormone_1 16 82 9.9e-8 PFAM
Pfam:Hormone_1 82 256 2.6e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095924
AA Change: Q129L

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093614
Gene: ENSMUSG00000006488
AA Change: Q129L

DomainStartEndE-ValueType
Pfam:Hormone_1 17 257 7.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224852
AA Change: Q128L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1663 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (55/58)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Alpk2 T A 18: 65,300,141 I1765F probably damaging Het
Ano5 T A 7: 51,587,666 I696N probably damaging Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Atad2b A G 12: 4,985,710 N759D probably benign Het
B4galnt4 T C 7: 141,061,326 L18P probably damaging Het
Boc T C 16: 44,491,884 D605G probably damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Clip2 A G 5: 134,535,197 probably benign Het
Cog4 T C 8: 110,858,612 I303T probably damaging Het
Col18a1 C T 10: 77,096,167 V363I unknown Het
Crip3 A T 17: 46,431,230 K184* probably null Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dnah3 G A 7: 120,029,025 Q1459* probably null Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Ehhadh T G 16: 21,762,688 D518A probably damaging Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fbxl3 G A 14: 103,089,418 S176L probably damaging Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ifi214 A T 1: 173,524,943 S307T possibly damaging Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Large2 A G 2: 92,366,605 probably benign Het
Myo5c T C 9: 75,283,942 I1086T probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Olfr1002 T A 2: 85,648,303 Q6L probably damaging Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Olfr583 T C 7: 103,051,796 V166A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Plcb1 A T 2: 135,344,158 I682F probably damaging Het
Plcz1 T A 6: 140,040,618 probably null Het
Prrt4 T C 6: 29,170,164 Y763C probably damaging Het
Psma7 T C 2: 180,039,511 probably benign Het
Serpinb6b G C 13: 32,972,263 C112S probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Slc35f5 G A 1: 125,572,474 A242T possibly damaging Het
Speer4b T C 5: 27,501,313 R19G probably benign Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trbv12-2 A G 6: 41,118,897 N12D probably benign Het
Uba7 T C 9: 107,976,802 probably null Het
Upf3a A G 8: 13,796,591 R324G probably benign Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Wbp2 G A 11: 116,080,547 probably benign Het
Wdpcp T A 11: 21,695,269 N232K probably damaging Het
Wdpcp T A 11: 21,695,271 M233K probably benign Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Other mutations in Prl7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Prl7a1 APN 13 27640795 missense probably damaging 0.97
IGL02862:Prl7a1 APN 13 27639889 missense probably benign 0.05
R0841:Prl7a1 UTSW 13 27642410 splice site probably benign
R1005:Prl7a1 UTSW 13 27642446 missense possibly damaging 0.75
R1641:Prl7a1 UTSW 13 27633629 missense probably damaging 1.00
R1991:Prl7a1 UTSW 13 27633672 missense probably damaging 0.96
R2233:Prl7a1 UTSW 13 27642419 critical splice donor site probably null
R4061:Prl7a1 UTSW 13 27635849 missense possibly damaging 0.83
R4817:Prl7a1 UTSW 13 27635764 missense probably damaging 0.99
R4976:Prl7a1 UTSW 13 27633581 missense possibly damaging 0.52
R4992:Prl7a1 UTSW 13 27635686 splice site probably null
R5119:Prl7a1 UTSW 13 27633581 missense possibly damaging 0.52
R5857:Prl7a1 UTSW 13 27640701 missense probably damaging 0.99
R6060:Prl7a1 UTSW 13 27637588 missense probably damaging 1.00
R6164:Prl7a1 UTSW 13 27637643 missense probably benign 0.00
R6581:Prl7a1 UTSW 13 27633629 missense probably damaging 1.00
R7126:Prl7a1 UTSW 13 27642419 critical splice donor site probably null
R7892:Prl7a1 UTSW 13 27633678 missense not run
R7908:Prl7a1 UTSW 13 27642450 start codon destroyed probably null 0.91
R8376:Prl7a1 UTSW 13 27637655 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACTTGTGACAGTATTACTTAGC -3'
(R):5'- CTAGGCCCAGATTCTAAGGAAAG -3'

Sequencing Primer
(F):5'- TGTGACAGTATTACTTAGCATTTCC -3'
(R):5'- TGAATTGAGGTTTGACATTCAGATG -3'
Posted On2015-06-12