Incidental Mutation 'R4239:B4galnt4'
ID321265
Institutional Source Beutler Lab
Gene Symbol B4galnt4
Ensembl Gene ENSMUSG00000055629
Gene Namebeta-1,4-N-acetyl-galactosaminyl transferase 4
SynonymsLOC381951
MMRRC Submission 041056-MU
Accession Numbers

Genbank: NM_177897; MGI: 2652891

Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R4239 (G1)
Quality Score122
Status Validated
Chromosome7
Chromosomal Location141061104-141072400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141061326 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 18 (L18P)
Ref Sequence ENSEMBL: ENSMUSP00000039758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048002]
Predicted Effect probably damaging
Transcript: ENSMUST00000048002
AA Change: L18P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039758
Gene: ENSMUSG00000055629
AA Change: L18P

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
PA14 129 276 6.07e-7 SMART
low complexity region 412 421 N/A INTRINSIC
low complexity region 433 449 N/A INTRINSIC
low complexity region 461 481 N/A INTRINSIC
low complexity region 634 660 N/A INTRINSIC
Pfam:CHGN 691 1024 8.9e-31 PFAM
Pfam:Glyco_transf_7C 939 1017 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210203
Meta Mutation Damage Score 0.4212 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (55/58)
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Alpk2 T A 18: 65,300,141 I1765F probably damaging Het
Ano5 T A 7: 51,587,666 I696N probably damaging Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Atad2b A G 12: 4,985,710 N759D probably benign Het
Boc T C 16: 44,491,884 D605G probably damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Clip2 A G 5: 134,535,197 probably benign Het
Cog4 T C 8: 110,858,612 I303T probably damaging Het
Col18a1 C T 10: 77,096,167 V363I unknown Het
Crip3 A T 17: 46,431,230 K184* probably null Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dnah3 G A 7: 120,029,025 Q1459* probably null Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Ehhadh T G 16: 21,762,688 D518A probably damaging Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fbxl3 G A 14: 103,089,418 S176L probably damaging Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ifi214 A T 1: 173,524,943 S307T possibly damaging Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Large2 A G 2: 92,366,605 probably benign Het
Myo5c T C 9: 75,283,942 I1086T probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Olfr1002 T A 2: 85,648,303 Q6L probably damaging Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Olfr583 T C 7: 103,051,796 V166A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Plcb1 A T 2: 135,344,158 I682F probably damaging Het
Plcz1 T A 6: 140,040,618 probably null Het
Prl7a1 T A 13: 27,637,566 Q129L possibly damaging Het
Prrt4 T C 6: 29,170,164 Y763C probably damaging Het
Psma7 T C 2: 180,039,511 probably benign Het
Serpinb6b G C 13: 32,972,263 C112S probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Slc35f5 G A 1: 125,572,474 A242T possibly damaging Het
Speer4b T C 5: 27,501,313 R19G probably benign Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trbv12-2 A G 6: 41,118,897 N12D probably benign Het
Uba7 T C 9: 107,976,802 probably null Het
Upf3a A G 8: 13,796,591 R324G probably benign Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Wbp2 G A 11: 116,080,547 probably benign Het
Wdpcp T A 11: 21,695,269 N232K probably damaging Het
Wdpcp T A 11: 21,695,271 M233K probably benign Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Other mutations in B4galnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:B4galnt4 APN 7 141070515 missense probably benign 0.15
IGL02055:B4galnt4 APN 7 141070818 missense probably damaging 1.00
IGL02248:B4galnt4 APN 7 141067808 unclassified probably benign
IGL02955:B4galnt4 APN 7 141064678 missense probably null 0.08
IGL03334:B4galnt4 APN 7 141067441 splice site probably null
H8786:B4galnt4 UTSW 7 141071322 missense probably damaging 0.99
R0520:B4galnt4 UTSW 7 141067373 nonsense probably null
R0735:B4galnt4 UTSW 7 141064323 missense probably benign 0.24
R1355:B4galnt4 UTSW 7 141065395 missense probably damaging 1.00
R1864:B4galnt4 UTSW 7 141070533 missense probably damaging 1.00
R1874:B4galnt4 UTSW 7 141070526 missense probably damaging 1.00
R1928:B4galnt4 UTSW 7 141068148 nonsense probably null
R1969:B4galnt4 UTSW 7 141064848 missense probably benign 0.01
R3429:B4galnt4 UTSW 7 141070839 missense probably damaging 1.00
R4382:B4galnt4 UTSW 7 141070536 missense probably damaging 0.99
R4517:B4galnt4 UTSW 7 141067722 missense probably damaging 1.00
R4748:B4galnt4 UTSW 7 141071720 missense probably damaging 1.00
R4827:B4galnt4 UTSW 7 141068479 missense probably benign 0.00
R4831:B4galnt4 UTSW 7 141067721 missense probably damaging 0.99
R4831:B4galnt4 UTSW 7 141064557 critical splice donor site probably null
R4898:B4galnt4 UTSW 7 141068260 missense probably benign 0.11
R5028:B4galnt4 UTSW 7 141068062 missense probably benign 0.40
R5249:B4galnt4 UTSW 7 141065070 missense probably damaging 1.00
R5267:B4galnt4 UTSW 7 141070611 missense probably damaging 0.99
R5728:B4galnt4 UTSW 7 141070575 missense probably benign 0.00
R5924:B4galnt4 UTSW 7 141070829 missense probably damaging 1.00
R6063:B4galnt4 UTSW 7 141064730 missense probably benign 0.08
R6311:B4galnt4 UTSW 7 141068659 missense probably damaging 1.00
R6376:B4galnt4 UTSW 7 141067422 missense possibly damaging 0.87
R6689:B4galnt4 UTSW 7 141067984 missense probably benign 0.25
R6954:B4galnt4 UTSW 7 141067232 missense probably benign 0.01
R6974:B4galnt4 UTSW 7 141067536 missense possibly damaging 0.95
R7041:B4galnt4 UTSW 7 141070680 missense probably damaging 1.00
R7092:B4galnt4 UTSW 7 141068636 missense probably damaging 1.00
R7359:B4galnt4 UTSW 7 141071284 missense probably damaging 1.00
R7367:B4galnt4 UTSW 7 141064475 missense probably damaging 1.00
R7409:B4galnt4 UTSW 7 141067003 splice site probably null
R7519:B4galnt4 UTSW 7 141064344 missense probably damaging 1.00
R7664:B4galnt4 UTSW 7 141067713 missense probably damaging 1.00
R7679:B4galnt4 UTSW 7 141067765 missense probably benign 0.28
R7782:B4galnt4 UTSW 7 141065075 missense probably damaging 1.00
R8103:B4galnt4 UTSW 7 141064651 missense possibly damaging 0.91
R8783:B4galnt4 UTSW 7 141063846 missense probably damaging 1.00
R8796:B4galnt4 UTSW 7 141067575 missense probably damaging 1.00
RF007:B4galnt4 UTSW 7 141070696 critical splice donor site probably null
YA93:B4galnt4 UTSW 7 141067411 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TCACGGATTGGTTGTACGCG -3'
(R):5'- CCAATATAGCTGAGCTGGGAG -3'

Sequencing Primer
(F):5'- TAGTGGCCGAATCCCGTAGTC -3'
(R):5'- CTGAGCTGGGAGGAGCAG -3'
Posted On2015-06-12