Incidental Mutation 'R4239:Crip3'
ID321287
Institutional Source Beutler Lab
Gene Symbol Crip3
Ensembl Gene ENSMUSG00000023968
Gene Namecysteine-rich protein 3
SynonymsTLP, TLP-A
MMRRC Submission 041056-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4239 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46428926-46431776 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 46431230 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 184 (K184*)
Ref Sequence ENSEMBL: ENSMUSP00000130072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024764] [ENSMUST00000087012] [ENSMUST00000113465] [ENSMUST00000165993]
Predicted Effect probably null
Transcript: ENSMUST00000024764
AA Change: K184*
SMART Domains Protein: ENSMUSP00000024764
Gene: ENSMUSG00000023968
AA Change: K184*

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087012
SMART Domains Protein: ENSMUSP00000084234
Gene: ENSMUSG00000067144

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:MFS_1 82 479 1.2e-32 PFAM
Pfam:Sugar_tr 86 524 2.5e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113465
AA Change: K184*
SMART Domains Protein: ENSMUSP00000109092
Gene: ENSMUSG00000023968
AA Change: K184*

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165811
Predicted Effect probably null
Transcript: ENSMUST00000165993
AA Change: K184*
SMART Domains Protein: ENSMUSP00000130072
Gene: ENSMUSG00000023968
AA Change: K184*

DomainStartEndE-ValueType
LIM 4 56 9.54e-12 SMART
LIM 123 175 2.19e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169441
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (55/58)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit a decrease in thymocyte cellularity, though thymocyte development and thymic architecture appear to be normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,980,842 D397G probably benign Het
Alpk2 T A 18: 65,300,141 I1765F probably damaging Het
Ano5 T A 7: 51,587,666 I696N probably damaging Het
Areg A T 5: 91,143,516 N106I probably damaging Het
Atad2b A G 12: 4,985,710 N759D probably benign Het
B4galnt4 T C 7: 141,061,326 L18P probably damaging Het
Boc T C 16: 44,491,884 D605G probably damaging Het
Cfap46 G T 7: 139,666,287 Q387K possibly damaging Het
Cfap74 C A 4: 155,463,072 H1238Q probably benign Het
Clip2 A G 5: 134,535,197 probably benign Het
Cog4 T C 8: 110,858,612 I303T probably damaging Het
Col18a1 C T 10: 77,096,167 V363I unknown Het
Ddi1 A G 9: 6,265,799 M190T probably benign Het
Dnah3 G A 7: 120,029,025 Q1459* probably null Het
Dpp8 A G 9: 65,054,923 D415G probably benign Het
Ehhadh T G 16: 21,762,688 D518A probably damaging Het
Erbb2 A G 11: 98,428,043 K549R probably benign Het
Fbxl3 G A 14: 103,089,418 S176L probably damaging Het
Gm1979 T C 5: 26,001,121 T154A probably benign Het
Gm6871 G T 7: 41,545,780 T511K probably damaging Het
Gtf2h1 C T 7: 46,805,065 A157V probably benign Het
Hexb T C 13: 97,176,751 probably benign Het
Ifi214 A T 1: 173,524,943 S307T possibly damaging Het
Ighv3-4 A T 12: 114,253,913 D19E probably benign Het
Klk6 A G 7: 43,829,173 H168R probably benign Het
Large2 A G 2: 92,366,605 probably benign Het
Myo5c T C 9: 75,283,942 I1086T probably benign Het
Nes C A 3: 87,979,359 P1598T probably damaging Het
Olfr1002 T A 2: 85,648,303 Q6L probably damaging Het
Olfr539 A G 7: 140,667,583 N99D probably benign Het
Olfr583 T C 7: 103,051,796 V166A probably benign Het
Otud7a A G 7: 63,650,954 D47G probably damaging Het
Phactr1 T A 13: 43,094,887 N437K possibly damaging Het
Plcb1 A T 2: 135,344,158 I682F probably damaging Het
Plcz1 T A 6: 140,040,618 probably null Het
Prl7a1 T A 13: 27,637,566 Q129L possibly damaging Het
Prrt4 T C 6: 29,170,164 Y763C probably damaging Het
Psma7 T C 2: 180,039,511 probably benign Het
Serpinb6b G C 13: 32,972,263 C112S probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Slc35f5 G A 1: 125,572,474 A242T possibly damaging Het
Speer4b T C 5: 27,501,313 R19G probably benign Het
Trank1 A G 9: 111,367,035 I1376V probably benign Het
Trbv12-2 A G 6: 41,118,897 N12D probably benign Het
Uba7 T C 9: 107,976,802 probably null Het
Upf3a A G 8: 13,796,591 R324G probably benign Het
Usp46 T G 5: 74,032,267 probably benign Het
Vmn2r14 T G 5: 109,216,411 probably null Het
Wbp2 G A 11: 116,080,547 probably benign Het
Wdpcp T A 11: 21,695,271 M233K probably benign Het
Wdpcp T A 11: 21,695,269 N232K probably damaging Het
Zfp157 A G 5: 138,447,541 I53V probably damaging Het
Other mutations in Crip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0023:Crip3 UTSW 17 46430994 missense probably damaging 0.97
R1476:Crip3 UTSW 17 46430776 splice site probably benign
R2197:Crip3 UTSW 17 46429412 missense probably damaging 1.00
R2255:Crip3 UTSW 17 46429372 missense probably damaging 1.00
R4668:Crip3 UTSW 17 46429364 missense probably damaging 1.00
R4786:Crip3 UTSW 17 46431042 missense possibly damaging 0.77
R4858:Crip3 UTSW 17 46430747 intron probably benign
R5996:Crip3 UTSW 17 46431284 missense possibly damaging 0.46
R6560:Crip3 UTSW 17 46431036 missense probably damaging 1.00
R7084:Crip3 UTSW 17 46430790 missense probably benign
R7626:Crip3 UTSW 17 46429865 missense probably benign 0.08
X0067:Crip3 UTSW 17 46429827 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGAAATTGGCACCGACCCTG -3'
(R):5'- ATAGATGTAGCAGCCCACATCG -3'

Sequencing Primer
(F):5'- TGAGGTGCCAACGTTGCAG -3'
(R):5'- GCCAATGTTCACACCTGAAGGAG -3'
Posted On2015-06-12