Incidental Mutation 'R2091:Lamb1'
ID 323567
Institutional Source Beutler Lab
Gene Symbol Lamb1
Ensembl Gene ENSMUSG00000002900
Gene Name laminin B1
Synonyms C80098, C81607, Lamb1-1, Lamb-1, D130003D08Rik
MMRRC Submission 040096-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2091 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 31265234-31329644 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31287429 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 386 (N386K)
Ref Sequence ENSEMBL: ENSMUSP00000002979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]
AlphaFold P02469
Predicted Effect probably damaging
Transcript: ENSMUST00000002979
AA Change: N386K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: N386K

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
EGF_Lam 558 602 3.4e-8 SMART
EGF_Lam 821 866 4.99e-15 SMART
EGF_Lam 869 912 2.38e-12 SMART
EGF_Lam 915 962 2.4e-8 SMART
EGF_Lam 965 1021 1.41e-5 SMART
EGF_Lam 1024 1073 4.81e-8 SMART
EGF_Lam 1076 1129 3.81e-11 SMART
EGF_Lam 1132 1177 5.61e-9 SMART
EGF_Lam 1180 1224 2.89e-11 SMART
coiled coil region 1329 1360 N/A INTRINSIC
low complexity region 1468 1480 N/A INTRINSIC
coiled coil region 1497 1551 N/A INTRINSIC
coiled coil region 1600 1826 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164919
AA Change: N386K

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132616
Gene: ENSMUSG00000002900
AA Change: N386K

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169065
Predicted Effect possibly damaging
Transcript: ENSMUST00000169088
AA Change: N338K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: N338K

DomainStartEndE-ValueType
LamNT 29 269 3.24e-96 SMART
EGF_Lam 271 332 1.34e-6 SMART
EGF_Lam 335 395 1.33e-10 SMART
EGF_Lam 398 455 2.89e-11 SMART
EGF_Lam 458 507 2.89e-11 SMART
EGF_Lam 510 554 3.4e-8 SMART
EGF_Lam 773 818 4.99e-15 SMART
EGF_Lam 821 864 2.38e-12 SMART
EGF_Lam 867 914 2.4e-8 SMART
EGF_Lam 917 973 1.41e-5 SMART
EGF_Lam 976 1025 4.81e-8 SMART
EGF_Lam 1028 1081 3.81e-11 SMART
EGF_Lam 1084 1129 5.61e-9 SMART
EGF_Lam 1132 1176 2.89e-11 SMART
coiled coil region 1281 1312 N/A INTRINSIC
low complexity region 1420 1432 N/A INTRINSIC
coiled coil region 1449 1503 N/A INTRINSIC
coiled coil region 1552 1778 N/A INTRINSIC
Meta Mutation Damage Score 0.8851 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 96% (55/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G C 2: 19,517,546 N247K probably damaging Het
4930402F06Rik T C 2: 35,376,067 K197R probably benign Het
4932438A13Rik C T 3: 36,988,256 T2797I probably damaging Het
4932438A13Rik T C 3: 36,953,970 V1725A probably damaging Het
9130011E15Rik A T 19: 45,952,680 L300Q probably damaging Het
AA986860 T C 1: 130,743,169 L376P probably benign Het
Adamts10 T C 17: 33,551,192 probably null Het
Adamts7 T C 9: 90,188,440 probably null Het
Adgrl1 T C 8: 83,934,464 I862T probably damaging Het
Agbl1 G A 7: 76,589,500 V583M probably damaging Het
Apba2 T A 7: 64,695,593 V177D probably benign Het
Arfgap2 A G 2: 91,270,241 K297R probably benign Het
Atg14 A T 14: 47,542,895 I474N probably damaging Het
Atp2b4 C A 1: 133,715,230 V1046F probably benign Het
Best1 A G 19: 9,992,079 V205A probably benign Het
Bicdl1 A G 5: 115,724,579 S206P probably damaging Het
Cacna1h C T 17: 25,432,876 C98Y possibly damaging Het
Calhm3 T A 19: 47,151,991 D221V probably damaging Het
Ccdc93 T A 1: 121,483,342 probably null Het
Cd248 A T 19: 5,070,046 I641F possibly damaging Het
Chrnb3 C T 8: 27,394,234 T333M probably damaging Het
Cyb5rl A G 4: 107,071,006 H113R probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddx59 T A 1: 136,416,709 D39E probably benign Het
Defa5 A G 8: 21,297,497 D20G probably damaging Het
Dido1 A T 2: 180,661,884 V1409E probably benign Het
Dlc1 A T 8: 36,937,609 V342E probably benign Het
Dsc2 G A 18: 20,033,294 T760I possibly damaging Het
Dync1h1 A G 12: 110,649,588 I3057V probably benign Het
Etnk2 T G 1: 133,377,053 probably null Het
Fbp2 G T 13: 62,858,207 L31I probably damaging Het
Gbp7 A T 3: 142,534,622 I34F probably damaging Het
Gcfc2 A G 6: 81,943,479 E415G probably damaging Het
Glp1r T C 17: 30,925,549 L232P probably damaging Het
Gm10822 A G 2: 73,899,275 noncoding transcript Het
Gm42669 G A 5: 107,507,910 V1192M probably benign Het
Gpr37 A G 6: 25,689,063 S12P possibly damaging Het
Gpt A G 15: 76,697,976 E211G possibly damaging Het
Grxcr1 T C 5: 68,110,412 I168T probably damaging Het
Hat1 T C 2: 71,434,034 V272A probably benign Het
Igkv8-30 A C 6: 70,117,086 C114G probably damaging Het
Kcne4 T C 1: 78,817,907 S91P probably benign Het
Kif5b G A 18: 6,213,248 Q715* probably null Het
Lcmt2 T C 2: 121,138,616 N662S probably damaging Het
Lnx1 G T 5: 74,620,066 H324N probably benign Het
Lrrc4 T G 6: 28,830,587 D343A probably benign Het
Mars A G 10: 127,299,285 S646P probably damaging Het
Mboat7 T C 7: 3,684,011 probably benign Het
Mlip C T 9: 77,164,863 V341I possibly damaging Het
Mterf1b A T 5: 4,197,057 T233S possibly damaging Het
Myo3a A T 2: 22,333,677 H442L probably damaging Het
Myrf A T 19: 10,224,600 V171D possibly damaging Het
Nbas G A 12: 13,361,045 D897N probably benign Het
Nfx1 T C 4: 40,977,004 V226A probably benign Het
Nlrp4a T C 7: 26,450,153 L395P probably damaging Het
Nrros C T 16: 32,144,157 W311* probably null Het
Nsun6 A G 2: 15,039,731 probably null Het
Ntrk2 A G 13: 58,859,301 H239R possibly damaging Het
Olfr1301 A T 2: 111,754,386 M46L probably benign Het
Olfr259 T C 2: 87,108,262 N42D probably damaging Het
Olfr495 A G 7: 108,395,861 H247R probably damaging Het
Olfr979 T C 9: 40,001,204 T8A probably benign Het
Pate4 C A 9: 35,608,257 A46S possibly damaging Het
Pcdhb18 T C 18: 37,490,600 S328P probably damaging Het
Pdk4 A G 6: 5,494,857 probably benign Het
Pigm T C 1: 172,377,533 Y279H probably damaging Het
Pla2g16 A G 19: 7,579,109 I92V probably damaging Het
Plxdc2 A G 2: 16,713,683 I379M probably damaging Het
Ppp1r35 A G 5: 137,779,894 N217S possibly damaging Het
Prex1 G A 2: 166,569,365 T1438I possibly damaging Het
Ptger4 T A 15: 5,242,845 I98F possibly damaging Het
Rasl11a T A 5: 146,847,117 I124N probably damaging Het
Rest A G 5: 77,281,279 K515R possibly damaging Het
Ryr1 A G 7: 29,086,049 L1746P probably damaging Het
Ryr2 G T 13: 11,945,977 T25K probably benign Het
Sacs A T 14: 61,191,919 I476L possibly damaging Het
Serpina3g A T 12: 104,239,158 D52V probably damaging Het
Skint6 T C 4: 112,846,684 N998S probably benign Het
Skp2 C A 15: 9,113,698 G376C probably damaging Het
Slc10a4 G A 5: 73,017,139 probably benign Het
Slc24a2 G T 4: 87,011,646 P538T probably damaging Het
Sntg1 T A 1: 8,595,539 T184S probably benign Het
Ssbp1 A G 6: 40,476,499 Y73C probably null Het
St18 G A 1: 6,827,971 V666M probably benign Het
Suclg1 A G 6: 73,264,276 K193R probably benign Het
Tcp11l1 T C 2: 104,684,139 I428V possibly damaging Het
Th T A 7: 142,895,543 D275V probably damaging Het
Tnrc18 A C 5: 142,773,641 S813R unknown Het
Tnrc6a T C 7: 123,172,120 probably null Het
Trap1 A C 16: 4,046,039 Y472* probably null Het
Trdv1 C A 14: 53,882,169 Q96K probably benign Het
Trpm8 T C 1: 88,343,326 I446T probably damaging Het
Tti2 T C 8: 31,154,266 L297P probably damaging Het
Ttn C T 2: 76,735,011 G26545R probably damaging Het
Ttn T C 2: 76,757,144 D13208G probably damaging Het
Tubb3 A G 8: 123,421,678 probably null Het
Umodl1 A G 17: 30,971,919 M247V probably benign Het
Wrn T A 8: 33,267,825 H812L probably benign Het
Zfp174 A G 16: 3,854,642 R352G possibly damaging Het
Zfp955a T A 17: 33,242,757 K134* probably null Het
Other mutations in Lamb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Lamb1 APN 12 31298826 missense possibly damaging 0.74
IGL00939:Lamb1 APN 12 31302927 missense probably damaging 1.00
IGL01017:Lamb1 APN 12 31301064 missense possibly damaging 0.89
IGL01384:Lamb1 APN 12 31320931 missense probably benign 0.09
IGL01470:Lamb1 APN 12 31300262 missense possibly damaging 0.55
IGL01554:Lamb1 APN 12 31306977 missense probably damaging 1.00
IGL02207:Lamb1 APN 12 31329435 missense probably damaging 1.00
IGL02271:Lamb1 APN 12 31300251 missense probably damaging 1.00
IGL02272:Lamb1 APN 12 31305769 missense probably benign 0.00
IGL02365:Lamb1 APN 12 31318345 missense probably damaging 1.00
IGL02471:Lamb1 APN 12 31320908 missense probably damaging 1.00
IGL02704:Lamb1 APN 12 31318467 missense probably benign 0.05
IGL03132:Lamb1 APN 12 31300334 splice site probably null
IGL03161:Lamb1 APN 12 31326256 missense probably benign 0.41
IGL03169:Lamb1 APN 12 31323646 missense probably damaging 1.00
Crush UTSW 12 31287424 missense probably damaging 1.00
Deflationary UTSW 12 31321075 missense probably null 0.63
E0374:Lamb1 UTSW 12 31287930 missense probably damaging 1.00
P0043:Lamb1 UTSW 12 31278621 missense probably damaging 1.00
R0031:Lamb1 UTSW 12 31301156 missense probably benign 0.04
R0047:Lamb1 UTSW 12 31278601 missense possibly damaging 0.51
R0047:Lamb1 UTSW 12 31278601 missense possibly damaging 0.51
R0285:Lamb1 UTSW 12 31326645 nonsense probably null
R0456:Lamb1 UTSW 12 31304730 missense probably damaging 1.00
R0477:Lamb1 UTSW 12 31326269 missense possibly damaging 0.47
R0480:Lamb1 UTSW 12 31282721 missense possibly damaging 0.79
R0544:Lamb1 UTSW 12 31282695 missense probably damaging 1.00
R0565:Lamb1 UTSW 12 31298915 missense probably benign 0.02
R1500:Lamb1 UTSW 12 31298949 missense possibly damaging 0.82
R1624:Lamb1 UTSW 12 31278652 critical splice donor site probably null
R1772:Lamb1 UTSW 12 31278525 missense probably damaging 1.00
R1836:Lamb1 UTSW 12 31301094 missense probably benign 0.00
R1853:Lamb1 UTSW 12 31318272 missense probably damaging 1.00
R1854:Lamb1 UTSW 12 31318272 missense probably damaging 1.00
R1903:Lamb1 UTSW 12 31329210 missense probably damaging 1.00
R2186:Lamb1 UTSW 12 31318467 nonsense probably null
R2268:Lamb1 UTSW 12 31327645 missense probably damaging 1.00
R2567:Lamb1 UTSW 12 31269055 critical splice acceptor site probably null
R2698:Lamb1 UTSW 12 31298883 missense probably benign 0.10
R3121:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3405:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3406:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3608:Lamb1 UTSW 12 31287910 missense probably damaging 1.00
R3725:Lamb1 UTSW 12 31321075 missense probably null 0.63
R3726:Lamb1 UTSW 12 31321075 missense probably null 0.63
R3949:Lamb1 UTSW 12 31282649 missense probably damaging 1.00
R4308:Lamb1 UTSW 12 31329255 missense probably damaging 1.00
R4600:Lamb1 UTSW 12 31323529 missense probably benign 0.00
R4604:Lamb1 UTSW 12 31278776 missense probably damaging 1.00
R4701:Lamb1 UTSW 12 31266848 nonsense probably null
R4710:Lamb1 UTSW 12 31282583 missense probably benign 0.02
R4767:Lamb1 UTSW 12 31308011 missense probably damaging 1.00
R4809:Lamb1 UTSW 12 31278526 missense probably damaging 1.00
R4828:Lamb1 UTSW 12 31298930 missense probably benign
R4842:Lamb1 UTSW 12 31287433 missense probably damaging 1.00
R4864:Lamb1 UTSW 12 31321006 missense probably benign 0.01
R4909:Lamb1 UTSW 12 31288281 missense probably damaging 1.00
R4989:Lamb1 UTSW 12 31326678 missense probably damaging 1.00
R5444:Lamb1 UTSW 12 31298909 missense possibly damaging 0.47
R5736:Lamb1 UTSW 12 31302665 nonsense probably null
R5766:Lamb1 UTSW 12 31299931 missense probably damaging 1.00
R5825:Lamb1 UTSW 12 31318614 missense probably benign
R5840:Lamb1 UTSW 12 31266756 missense probably damaging 1.00
R5867:Lamb1 UTSW 12 31298955 missense possibly damaging 0.82
R5887:Lamb1 UTSW 12 31266864 nonsense probably null
R5984:Lamb1 UTSW 12 31327774 missense possibly damaging 0.76
R6313:Lamb1 UTSW 12 31269147 missense probably damaging 1.00
R6359:Lamb1 UTSW 12 31282716 missense probably damaging 0.97
R6505:Lamb1 UTSW 12 31323462 missense possibly damaging 0.63
R7127:Lamb1 UTSW 12 31324315 missense probably damaging 1.00
R7202:Lamb1 UTSW 12 31324315 missense probably damaging 1.00
R7271:Lamb1 UTSW 12 31287424 missense probably damaging 1.00
R7290:Lamb1 UTSW 12 31265596 missense probably benign 0.04
R7486:Lamb1 UTSW 12 31287442 missense probably benign 0.00
R7496:Lamb1 UTSW 12 31300021 missense probably benign 0.31
R7591:Lamb1 UTSW 12 31326648 missense probably damaging 1.00
R7722:Lamb1 UTSW 12 31323571 missense probably damaging 0.99
R7985:Lamb1 UTSW 12 31300215 missense possibly damaging 0.93
R8058:Lamb1 UTSW 12 31303047 missense probably benign 0.16
R8353:Lamb1 UTSW 12 31306999 missense probably damaging 1.00
R8506:Lamb1 UTSW 12 31329361 missense probably damaging 1.00
R8846:Lamb1 UTSW 12 31329389 missense possibly damaging 0.75
R8888:Lamb1 UTSW 12 31302954 missense possibly damaging 0.95
R8895:Lamb1 UTSW 12 31302954 missense possibly damaging 0.95
R9312:Lamb1 UTSW 12 31318353 missense probably damaging 1.00
R9340:Lamb1 UTSW 12 31324224 missense probably benign
R9340:Lamb1 UTSW 12 31324225 missense probably benign
R9371:Lamb1 UTSW 12 31298864 missense probably damaging 0.98
R9417:Lamb1 UTSW 12 31287984 missense probably damaging 1.00
X0054:Lamb1 UTSW 12 31287434 missense probably damaging 1.00
X0064:Lamb1 UTSW 12 31303042 missense probably benign 0.35
Z1176:Lamb1 UTSW 12 31327702 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TCATCACCAGAGGCTTCTTGC -3'
(R):5'- ATCCTGCGTGAGAAGTGAAG -3'

Sequencing Primer
(F):5'- GCTGTTTGACTCACACACAC -3'
(R):5'- CCGACGTACGTTCACAGAGATTG -3'
Posted On 2015-06-24