Mutagenetix > Incidental Mutation

Incidental Mutation 'R6313:Lamb1'

510536

Institutional Source

Beutler Lab

Gene Symbol

Lamb1

Ensembl Gene

ENSMUSG00000002900

Gene Name

laminin B1

Synonyms

C80098, C81607, Lamb1-1, Lamb-1, D130003D08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6313 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31265234-31329644 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31269147 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 102 (T102S)

Ref Sequence

ENSEMBL: ENSMUSP00000132778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088] [ENSMUST00000170495]

AlphaFold

P02469

PDB Structure

Laminin beta1 LN-LE1-4 structure [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000002979
AA Change: T150S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: T150S

Domain	Start	End	E-Value	Type
low complexity region	32	45	N/A	INTRINSIC
LamNT	77	317	3.24e-96	SMART
EGF_Lam	319	380	1.34e-6	SMART
EGF_Lam	383	443	1.33e-10	SMART
EGF_Lam	446	503	2.89e-11	SMART
EGF_Lam	506	555	2.89e-11	SMART
EGF_Lam	558	602	3.4e-8	SMART
EGF_Lam	821	866	4.99e-15	SMART
EGF_Lam	869	912	2.38e-12	SMART
EGF_Lam	915	962	2.4e-8	SMART
EGF_Lam	965	1021	1.41e-5	SMART
EGF_Lam	1024	1073	4.81e-8	SMART
EGF_Lam	1076	1129	3.81e-11	SMART
EGF_Lam	1132	1177	5.61e-9	SMART
EGF_Lam	1180	1224	2.89e-11	SMART
coiled coil region	1329	1360	N/A	INTRINSIC
low complexity region	1468	1480	N/A	INTRINSIC
coiled coil region	1497	1551	N/A	INTRINSIC
coiled coil region	1600	1826	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164228

Predicted Effect

probably damaging
Transcript: ENSMUST00000169088
AA Change: T102S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: T102S

Domain	Start	End	E-Value	Type
LamNT	29	269	3.24e-96	SMART
EGF_Lam	271	332	1.34e-6	SMART
EGF_Lam	335	395	1.33e-10	SMART
EGF_Lam	398	455	2.89e-11	SMART
EGF_Lam	458	507	2.89e-11	SMART
EGF_Lam	510	554	3.4e-8	SMART
EGF_Lam	773	818	4.99e-15	SMART
EGF_Lam	821	864	2.38e-12	SMART
EGF_Lam	867	914	2.4e-8	SMART
EGF_Lam	917	973	1.41e-5	SMART
EGF_Lam	976	1025	4.81e-8	SMART
EGF_Lam	1028	1081	3.81e-11	SMART
EGF_Lam	1084	1129	5.61e-9	SMART
EGF_Lam	1132	1176	2.89e-11	SMART
coiled coil region	1281	1312	N/A	INTRINSIC
low complexity region	1420	1432	N/A	INTRINSIC
coiled coil region	1449	1503	N/A	INTRINSIC
coiled coil region	1552	1778	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170495

SMART Domains

Protein: ENSMUSP00000132001
Gene: ENSMUSG00000002900

Domain	Start	End	E-Value	Type
low complexity region	32	45	N/A	INTRINSIC
low complexity region	68	82	N/A	INTRINSIC

Meta Mutation Damage Score

0.1107

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	C	T	9: 51,290,181	D192N	probably damaging	Het
4932415D10Rik	T	C	10: 82,293,636	N1180S	probably benign	Het
Abca16	T	C	7: 120,527,121	F1167L	probably damaging	Het
Abraxas2	G	A	7: 132,874,965	A145T	probably damaging	Het
Acaca	C	T	11: 84,292,929	T32I	probably benign	Het
Adam6a	A	T	12: 113,545,050	N348Y	possibly damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arhgef38	T	C	3: 133,234,708	D39G	possibly damaging	Het
Arid5b	T	C	10: 68,097,582	D587G	possibly damaging	Het
Brwd1	A	G	16: 96,007,941	V1963A	probably benign	Het
Ccdc136	T	A	6: 29,410,205	L34Q	probably damaging	Het
Cdh2	T	C	18: 16,774,522	Q53R	probably benign	Het
Celsr2	G	A	3: 108,401,214	S1799L	probably damaging	Het
Cenpe	A	G	3: 135,230,175	E457G	probably benign	Het
Cmtm1	A	T	8: 104,305,163	M283K	possibly damaging	Het
Dcdc5	T	C	2: 106,368,171		noncoding transcript	Het
Decr1	T	A	4: 15,924,261	M220L	probably benign	Het
Dgkg	T	G	16: 22,519,561	D592A	probably damaging	Het
Dkkl1	T	C	7: 45,211,438	Q39R	probably benign	Het
Dyrk1a	T	A	16: 94,659,514	C10S	possibly damaging	Het
Efcab2	A	T	1: 178,481,371	E146D	probably benign	Het
Efhc1	T	C	1: 20,979,428	V504A	possibly damaging	Het
Ermard	T	G	17: 15,053,205		probably null	Het
Espl1	T	C	15: 102,315,812	V1266A	probably benign	Het
Fbxw22	A	C	9: 109,403,397	V40G	probably damaging	Het
Gm3460	A	T	14: 6,619,410	I194N	possibly damaging	Het
Gnai2	C	T	9: 107,620,097	V33M	possibly damaging	Het
H2-DMb1	T	C	17: 34,157,532		probably null	Het
Hc	T	C	2: 34,989,839		probably null	Het
Iars	T	C	13: 49,708,445	S491P	probably damaging	Het
Knl1	T	A	2: 119,069,318	L500H	probably damaging	Het
Lrrc7	A	G	3: 158,160,736	S1123P	probably damaging	Het
Mettl5	C	A	2: 69,871,727		probably null	Het
Mmp11	A	G	10: 75,923,984	*4R	probably null	Het
Myom1	A	T	17: 71,082,488	D911V	probably benign	Het
Nid1	A	G	13: 13,463,782	T96A	probably benign	Het
Nlrp4e	G	T	7: 23,353,172	V839L	probably benign	Het
Notch3	A	T	17: 32,151,154		probably null	Het
Olfr1082	T	C	2: 86,594,067	T254A	possibly damaging	Het
Pcdh8	T	C	14: 79,767,651	H978R	probably benign	Het
Pde8b	A	T	13: 95,042,000	C537*	probably null	Het
Polr1b	T	C	2: 129,125,446	F920L	probably damaging	Het
Polr2f	A	G	15: 79,151,373	T87A	probably damaging	Het
Pon2	T	A	6: 5,272,421	H133L	probably damaging	Het
Ptk2b	T	A	14: 66,178,831	E205V	probably damaging	Het
Rb1cc1	T	A	1: 6,244,133	M343K	probably benign	Het
Rlf	G	A	4: 121,148,610	R1058W	probably damaging	Het
S100z	T	A	13: 95,478,574	K28*	probably null	Het
Scarf1	T	A	11: 75,520,315	N273K	probably benign	Het
Setd2	A	G	9: 110,556,366	I136M	unknown	Het
Sfrp2	A	G	3: 83,766,984	D148G	probably benign	Het
Slc24a4	A	G	12: 102,254,510	E400G	probably benign	Het
Slc2a9	T	G	5: 38,453,121	I112L	probably benign	Het
Smc5	A	T	19: 23,208,948	Y972*	probably null	Het
Sntg1	T	C	1: 8,445,024		probably null	Het
Stag1	A	G	9: 100,757,733	D114G	probably damaging	Het
Suclg1	T	C	6: 73,256,209	S46P	probably damaging	Het
Synj1	C	T	16: 90,946,815	A1186T	probably benign	Het
Tas2r124	A	G	6: 132,755,447	T240A	probably benign	Het
Tax1bp1	T	C	6: 52,744,356		probably null	Het
Tchh	C	A	3: 93,447,851	Q1533K	unknown	Het
Tmprss15	T	C	16: 78,962,170	T887A	probably benign	Het
Ttn	T	C	2: 76,706,593	I34963V	probably benign	Het
Unc79	G	A	12: 103,112,619	G1485D	probably damaging	Het
Usp9y	G	T	Y: 1,385,355	H633N	probably benign	Homo
Vmn2r99	A	T	17: 19,382,605	N541Y	probably damaging	Het
Zbtb11	T	A	16: 55,990,491	N337K	probably benign	Het
Zfp260	T	A	7: 30,104,842	C56S	possibly damaging	Het
Zfp457	C	T	13: 67,292,682	E610K	probably damaging	Het

Other mutations in Lamb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Lamb1	APN	12	31298826	missense	possibly damaging	0.74
IGL00939:Lamb1	APN	12	31302927	missense	probably damaging	1.00
IGL01017:Lamb1	APN	12	31301064	missense	possibly damaging	0.89
IGL01384:Lamb1	APN	12	31320931	missense	probably benign	0.09
IGL01470:Lamb1	APN	12	31300262	missense	possibly damaging	0.55
IGL01554:Lamb1	APN	12	31306977	missense	probably damaging	1.00
IGL02207:Lamb1	APN	12	31329435	missense	probably damaging	1.00
IGL02271:Lamb1	APN	12	31300251	missense	probably damaging	1.00
IGL02272:Lamb1	APN	12	31305769	missense	probably benign	0.00
IGL02365:Lamb1	APN	12	31318345	missense	probably damaging	1.00
IGL02471:Lamb1	APN	12	31320908	missense	probably damaging	1.00
IGL02704:Lamb1	APN	12	31318467	missense	probably benign	0.05
IGL03132:Lamb1	APN	12	31300334	splice site	probably null
IGL03161:Lamb1	APN	12	31326256	missense	probably benign	0.41
IGL03169:Lamb1	APN	12	31323646	missense	probably damaging	1.00
Crush	UTSW	12	31287424	missense	probably damaging	1.00
Deflationary	UTSW	12	31321075	missense	probably null	0.63
E0374:Lamb1	UTSW	12	31287930	missense	probably damaging	1.00
P0043:Lamb1	UTSW	12	31278621	missense	probably damaging	1.00
R0031:Lamb1	UTSW	12	31301156	missense	probably benign	0.04
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0285:Lamb1	UTSW	12	31326645	nonsense	probably null
R0456:Lamb1	UTSW	12	31304730	missense	probably damaging	1.00
R0477:Lamb1	UTSW	12	31326269	missense	possibly damaging	0.47
R0480:Lamb1	UTSW	12	31282721	missense	possibly damaging	0.79
R0544:Lamb1	UTSW	12	31282695	missense	probably damaging	1.00
R0565:Lamb1	UTSW	12	31298915	missense	probably benign	0.02
R1500:Lamb1	UTSW	12	31298949	missense	possibly damaging	0.82
R1624:Lamb1	UTSW	12	31278652	critical splice donor site	probably null
R1772:Lamb1	UTSW	12	31278525	missense	probably damaging	1.00
R1836:Lamb1	UTSW	12	31301094	missense	probably benign	0.00
R1853:Lamb1	UTSW	12	31318272	missense	probably damaging	1.00
R1854:Lamb1	UTSW	12	31318272	missense	probably damaging	1.00
R1903:Lamb1	UTSW	12	31329210	missense	probably damaging	1.00
R2091:Lamb1	UTSW	12	31287429	missense	probably damaging	0.98
R2186:Lamb1	UTSW	12	31318467	nonsense	probably null
R2268:Lamb1	UTSW	12	31327645	missense	probably damaging	1.00
R2567:Lamb1	UTSW	12	31269055	critical splice acceptor site	probably null
R2698:Lamb1	UTSW	12	31298883	missense	probably benign	0.10
R3121:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3405:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3406:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3608:Lamb1	UTSW	12	31287910	missense	probably damaging	1.00
R3725:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3726:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3949:Lamb1	UTSW	12	31282649	missense	probably damaging	1.00
R4308:Lamb1	UTSW	12	31329255	missense	probably damaging	1.00
R4600:Lamb1	UTSW	12	31323529	missense	probably benign	0.00
R4604:Lamb1	UTSW	12	31278776	missense	probably damaging	1.00
R4701:Lamb1	UTSW	12	31266848	nonsense	probably null
R4710:Lamb1	UTSW	12	31282583	missense	probably benign	0.02
R4767:Lamb1	UTSW	12	31308011	missense	probably damaging	1.00
R4809:Lamb1	UTSW	12	31278526	missense	probably damaging	1.00
R4828:Lamb1	UTSW	12	31298930	missense	probably benign
R4842:Lamb1	UTSW	12	31287433	missense	probably damaging	1.00
R4864:Lamb1	UTSW	12	31321006	missense	probably benign	0.01
R4909:Lamb1	UTSW	12	31288281	missense	probably damaging	1.00
R4989:Lamb1	UTSW	12	31326678	missense	probably damaging	1.00
R5444:Lamb1	UTSW	12	31298909	missense	possibly damaging	0.47
R5736:Lamb1	UTSW	12	31302665	nonsense	probably null
R5766:Lamb1	UTSW	12	31299931	missense	probably damaging	1.00
R5825:Lamb1	UTSW	12	31318614	missense	probably benign
R5840:Lamb1	UTSW	12	31266756	missense	probably damaging	1.00
R5867:Lamb1	UTSW	12	31298955	missense	possibly damaging	0.82
R5887:Lamb1	UTSW	12	31266864	nonsense	probably null
R5984:Lamb1	UTSW	12	31327774	missense	possibly damaging	0.76
R6359:Lamb1	UTSW	12	31282716	missense	probably damaging	0.97
R6505:Lamb1	UTSW	12	31323462	missense	possibly damaging	0.63
R7127:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7202:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7271:Lamb1	UTSW	12	31287424	missense	probably damaging	1.00
R7290:Lamb1	UTSW	12	31265596	missense	probably benign	0.04
R7486:Lamb1	UTSW	12	31287442	missense	probably benign	0.00
R7496:Lamb1	UTSW	12	31300021	missense	probably benign	0.31
R7591:Lamb1	UTSW	12	31326648	missense	probably damaging	1.00
R7722:Lamb1	UTSW	12	31323571	missense	probably damaging	0.99
R7985:Lamb1	UTSW	12	31300215	missense	possibly damaging	0.93
R8058:Lamb1	UTSW	12	31303047	missense	probably benign	0.16
R8353:Lamb1	UTSW	12	31306999	missense	probably damaging	1.00
R8506:Lamb1	UTSW	12	31329361	missense	probably damaging	1.00
R8846:Lamb1	UTSW	12	31329389	missense	possibly damaging	0.75
R8888:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R8895:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R9312:Lamb1	UTSW	12	31318353	missense	probably damaging	1.00
R9340:Lamb1	UTSW	12	31324224	missense	probably benign
R9340:Lamb1	UTSW	12	31324225	missense	probably benign
R9371:Lamb1	UTSW	12	31298864	missense	probably damaging	0.98
R9417:Lamb1	UTSW	12	31287984	missense	probably damaging	1.00
R9562:Lamb1	UTSW	12	31272493	missense	probably damaging	1.00
R9626:Lamb1	UTSW	12	31304670	missense	probably benign
R9641:Lamb1	UTSW	12	31287458	missense	probably damaging	0.97
X0054:Lamb1	UTSW	12	31287434	missense	probably damaging	1.00
X0064:Lamb1	UTSW	12	31303042	missense	probably benign	0.35
Z1176:Lamb1	UTSW	12	31327702	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- ACATTCATCTTTCTTGAAGGTGGTC -3'
(R):5'- AAGGCTGCTTCCTAACAGGG -3'

Sequencing Primer
(F):5'- ATCTTTCTTGAAGGTGGTCGTCTG -3'
(R):5'- TAACTGAGCAAGATGAGTGTTCC -3'

Posted On

2018-04-02