Mutagenetix > Incidental Mutation

Incidental Mutation 'R1854:Lamb1'

205958

Institutional Source

Beutler Lab

Gene Symbol

Lamb1

Ensembl Gene

ENSMUSG00000002900

Gene Name

laminin B1

Synonyms

C80098, C81607, Lamb1-1, Lamb-1, D130003D08Rik

MMRRC Submission

039878-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1854 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31265234-31329644 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 31318272 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 1134 (C1134G)

Ref Sequence

ENSEMBL: ENSMUSP00000132778 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]

AlphaFold

P02469

PDB Structure

Laminin beta1 LN-LE1-4 structure [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000002979
AA Change: C1182G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: C1182G

Domain	Start	End	E-Value	Type
low complexity region	32	45	N/A	INTRINSIC
LamNT	77	317	3.24e-96	SMART
EGF_Lam	319	380	1.34e-6	SMART
EGF_Lam	383	443	1.33e-10	SMART
EGF_Lam	446	503	2.89e-11	SMART
EGF_Lam	506	555	2.89e-11	SMART
EGF_Lam	558	602	3.4e-8	SMART
EGF_Lam	821	866	4.99e-15	SMART
EGF_Lam	869	912	2.38e-12	SMART
EGF_Lam	915	962	2.4e-8	SMART
EGF_Lam	965	1021	1.41e-5	SMART
EGF_Lam	1024	1073	4.81e-8	SMART
EGF_Lam	1076	1129	3.81e-11	SMART
EGF_Lam	1132	1177	5.61e-9	SMART
EGF_Lam	1180	1224	2.89e-11	SMART
coiled coil region	1329	1360	N/A	INTRINSIC
low complexity region	1468	1480	N/A	INTRINSIC
coiled coil region	1497	1551	N/A	INTRINSIC
coiled coil region	1600	1826	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169088
AA Change: C1134G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: C1134G

Domain	Start	End	E-Value	Type
LamNT	29	269	3.24e-96	SMART
EGF_Lam	271	332	1.34e-6	SMART
EGF_Lam	335	395	1.33e-10	SMART
EGF_Lam	398	455	2.89e-11	SMART
EGF_Lam	458	507	2.89e-11	SMART
EGF_Lam	510	554	3.4e-8	SMART
EGF_Lam	773	818	4.99e-15	SMART
EGF_Lam	821	864	2.38e-12	SMART
EGF_Lam	867	914	2.4e-8	SMART
EGF_Lam	917	973	1.41e-5	SMART
EGF_Lam	976	1025	4.81e-8	SMART
EGF_Lam	1028	1081	3.81e-11	SMART
EGF_Lam	1084	1129	5.61e-9	SMART
EGF_Lam	1132	1176	2.89e-11	SMART
coiled coil region	1281	1312	N/A	INTRINSIC
low complexity region	1420	1432	N/A	INTRINSIC
coiled coil region	1449	1503	N/A	INTRINSIC
coiled coil region	1552	1778	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061N02Rik	C	T	16: 88,707,780	R43K	possibly damaging	Het
Acp1	A	G	12: 30,897,805	I78T	possibly damaging	Het
Afap1l1	G	T	18: 61,743,294	D417E	probably benign	Het
Agap2	G	A	10: 127,080,516	V299I	unknown	Het
Ahnak	C	T	19: 9,013,832	A4160V	possibly damaging	Het
Anapc1	T	C	2: 128,675,890	E278G	probably damaging	Het
Atad2	G	A	15: 58,097,289	P971L	possibly damaging	Het
Atg2a	A	G	19: 6,252,431	E928G	probably benign	Het
Atp2b2	A	C	6: 113,842,283	N16K	probably damaging	Het
Atp6ap1l	T	C	13: 90,883,588	E325G	probably damaging	Het
Bfsp2	C	T	9: 103,449,831	G236S	probably benign	Het
Ccar1	A	T	10: 62,764,517	I545N	probably damaging	Het
Ccser2	A	G	14: 36,918,591	C11R	possibly damaging	Het
Cdc42bpg	A	T	19: 6,320,807	H1310L	possibly damaging	Het
Ces1h	T	C	8: 93,358,822	K339E	probably benign	Het
Cit	A	G	5: 115,873,901	Y189C	probably damaging	Het
Cnih3	C	A	1: 181,454,621	S140*	probably null	Het
Cntrl	A	G	2: 35,122,684	D278G	probably damaging	Het
Col24a1	G	A	3: 145,459,140	G1033D	probably damaging	Het
Col6a1	T	G	10: 76,721,949	Y151S	probably damaging	Het
Col6a2	T	A	10: 76,614,812	Q95L	probably damaging	Het
Cpd	G	T	11: 76,786,338	P1185Q	probably damaging	Het
Cycs	T	A	6: 50,565,329	I76F	possibly damaging	Het
Cyp4f16	T	A	17: 32,537,099	I34N	probably damaging	Het
Ddx1	A	C	12: 13,229,331	S436A	probably benign	Het
Defa30	A	G	8: 21,135,484	Y88C	probably damaging	Het
Dhx30	G	A	9: 110,088,672	L317F	probably damaging	Het
Dll3	C	A	7: 28,296,410	G322V	probably damaging	Het
Dnah10	G	A	5: 124,804,689	D2843N	probably damaging	Het
Dnaja3	C	T	16: 4,697,269	T266I	probably damaging	Het
Dpp9	T	C	17: 56,202,885	I314V	probably benign	Het
E030025P04Rik	A	G	11: 109,143,918	V48A	unknown	Het
Enpp2	C	T	15: 54,845,823	E803K	probably damaging	Het
Eri3	G	A	4: 117,649,365	G297D	probably benign	Het
Esp34	A	G	17: 38,559,533	E38G	possibly damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam122b	T	A	X: 53,254,056	Q201H	probably benign	Het
Frzb	A	G	2: 80,446,380	V154A	possibly damaging	Het
Fsip2	G	T	2: 82,993,257	A6445S	possibly damaging	Het
Gm11938	G	A	11: 99,603,017	T84I	possibly damaging	Het
Gm4787	T	A	12: 81,378,334	H350L	probably damaging	Het
Gpa33	A	G	1: 166,165,190	I291V	probably benign	Het
Gpr158	A	G	2: 21,369,124	Y290C	probably damaging	Het
Gpsm1	G	T	2: 26,344,713	G84W	probably damaging	Het
Hormad1	A	G	3: 95,580,006	N267S	probably benign	Het
Htr2a	A	T	14: 74,705,753	I258F	probably damaging	Het
Htra4	T	C	8: 25,033,581	T323A	probably damaging	Het
Ift140	T	A	17: 25,035,839	F162Y	probably benign	Het
Islr2	T	C	9: 58,199,816	T54A	probably damaging	Het
Kcna4	T	G	2: 107,296,484	V521G	probably damaging	Het
Kdr	C	T	5: 75,952,905	G768S	possibly damaging	Het
Kif6	G	T	17: 49,901,771	A740S	probably benign	Het
Lad1	T	A	1: 135,827,730	V248E	probably damaging	Het
Lamc1	A	G	1: 153,249,872	Y552H	probably damaging	Het
Maats1	T	C	16: 38,324,297		probably null	Het
Mctp1	A	T	13: 76,825,741	T706S	probably damaging	Het
Med12l	A	G	3: 59,260,772	Y1541C	probably damaging	Het
Mnx1	C	T	5: 29,477,782	S165N	unknown	Het
Morn3	A	T	5: 123,046,629		probably null	Het
Nalcn	C	T	14: 123,460,412	R484Q	probably damaging	Het
Nr4a1	T	C	15: 101,271,764	I305T	probably benign	Het
Olfr30	G	A	11: 58,455,431	R173W	probably damaging	Het
Olfr339	C	T	2: 36,421,874	H159Y	probably damaging	Het
Pcdhb5	T	C	18: 37,322,340	V591A	possibly damaging	Het
Pdia3	T	C	2: 121,431,663	I205T	probably benign	Het
Pdia4	A	T	6: 47,813,227	D26E	unknown	Het
Phactr3	C	A	2: 178,283,147	L292M	probably damaging	Het
Phf21b	T	A	15: 84,854,762	I21F	probably benign	Het
Pign	A	G	1: 105,554,498	V791A	probably damaging	Het
Pitpna	A	G	11: 75,609,103		probably null	Het
Piwil1	G	T	5: 128,747,839	E534*	probably null	Het
Plcz1	T	A	6: 139,993,049	I526F	probably benign	Het
Pms2	A	T	5: 143,925,896	K607I	probably benign	Het
Pnn	T	A	12: 59,071,613	N327K	probably damaging	Het
Pogz	C	T	3: 94,878,849	T863I	probably benign	Het
Polq	C	T	16: 37,062,109	T1545I	probably benign	Het
Psd4	G	A	2: 24,397,456	E467K	probably benign	Het
Pstpip2	T	A	18: 77,871,799	L198Q	probably damaging	Het
Pzp	T	C	6: 128,502,225	Y655C	probably damaging	Het
Qrsl1	C	T	10: 43,894,545	G117E	probably damaging	Het
Rad54b	G	A	4: 11,601,669	C408Y	probably damaging	Het
Ralb	T	A	1: 119,476,067	Q110L	possibly damaging	Het
Rrm2	A	G	12: 24,713,152	K218E	probably damaging	Het
Siglece	A	G	7: 43,659,936	F66S	probably benign	Het
Slc17a8	A	T	10: 89,606,765	C69S	unknown	Het
Slc1a6	T	A	10: 78,812,924	V493E	probably damaging	Het
Slc38a11	A	T	2: 65,363,516		probably null	Het
Smarcal1	G	A	1: 72,586,099	G135D	possibly damaging	Het
Snrnp70	T	A	7: 45,377,220	R242*	probably null	Het
St3gal5	T	C	6: 72,132,093	L55P	probably damaging	Het
Sulf1	A	G	1: 12,838,437	N558S	probably benign	Het
Supt6	T	C	11: 78,232,540	I104V	possibly damaging	Het
Tas2r113	T	A	6: 132,893,329	Y107N	probably damaging	Het
Tcf7	A	G	11: 52,257,064	V187A	probably benign	Het
Tdrd9	G	A	12: 112,044,812	G1152R	probably damaging	Het
Tfpi	A	G	2: 84,458,107	Y9H	probably benign	Het
Tnk2	G	A	16: 32,680,142	V758I	probably damaging	Het
Trim72	A	G	7: 128,009,082	I251V	probably benign	Het
Trip12	T	A	1: 84,728,145	N655Y	probably damaging	Het
Ttn	A	G	2: 76,751,429	V23040A	probably damaging	Het
Tulp2	T	A	7: 45,517,943	N188K	probably damaging	Het
Ube2c	C	T	2: 164,771,362	H67Y	probably damaging	Het
Unc80	C	A	1: 66,631,414	P1899T	possibly damaging	Het
Usp34	C	T	11: 23,426,153	A1879V	probably benign	Het
Vmn2r118	G	A	17: 55,611,556	S112L	possibly damaging	Het
Wdfy3	A	T	5: 101,888,186	V2122E	probably benign	Het
Zcchc4	A	G	5: 52,815,826	Y344C	probably damaging	Het
Zdbf2	GAAAAA	GAAAAAA	1: 63,305,542		probably null	Het
Zdhhc25	A	T	15: 88,600,486	H8L	probably benign	Het
Zfp455	A	T	13: 67,207,817	H383L	probably damaging	Het
Zfp663	A	G	2: 165,353,291	I336T	probably benign	Het
Zfp738	T	A	13: 67,670,357	H505L	probably damaging	Het
Zfp84	T	G	7: 29,775,371	F23V	possibly damaging	Het

Other mutations in Lamb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Lamb1	APN	12	31298826	missense	possibly damaging	0.74
IGL00939:Lamb1	APN	12	31302927	missense	probably damaging	1.00
IGL01017:Lamb1	APN	12	31301064	missense	possibly damaging	0.89
IGL01384:Lamb1	APN	12	31320931	missense	probably benign	0.09
IGL01470:Lamb1	APN	12	31300262	missense	possibly damaging	0.55
IGL01554:Lamb1	APN	12	31306977	missense	probably damaging	1.00
IGL02207:Lamb1	APN	12	31329435	missense	probably damaging	1.00
IGL02271:Lamb1	APN	12	31300251	missense	probably damaging	1.00
IGL02272:Lamb1	APN	12	31305769	missense	probably benign	0.00
IGL02365:Lamb1	APN	12	31318345	missense	probably damaging	1.00
IGL02471:Lamb1	APN	12	31320908	missense	probably damaging	1.00
IGL02704:Lamb1	APN	12	31318467	missense	probably benign	0.05
IGL03132:Lamb1	APN	12	31300334	splice site	probably null
IGL03161:Lamb1	APN	12	31326256	missense	probably benign	0.41
IGL03169:Lamb1	APN	12	31323646	missense	probably damaging	1.00
Crush	UTSW	12	31287424	missense	probably damaging	1.00
Deflationary	UTSW	12	31321075	missense	probably null	0.63
E0374:Lamb1	UTSW	12	31287930	missense	probably damaging	1.00
P0043:Lamb1	UTSW	12	31278621	missense	probably damaging	1.00
R0031:Lamb1	UTSW	12	31301156	missense	probably benign	0.04
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0047:Lamb1	UTSW	12	31278601	missense	possibly damaging	0.51
R0285:Lamb1	UTSW	12	31326645	nonsense	probably null
R0456:Lamb1	UTSW	12	31304730	missense	probably damaging	1.00
R0477:Lamb1	UTSW	12	31326269	missense	possibly damaging	0.47
R0480:Lamb1	UTSW	12	31282721	missense	possibly damaging	0.79
R0544:Lamb1	UTSW	12	31282695	missense	probably damaging	1.00
R0565:Lamb1	UTSW	12	31298915	missense	probably benign	0.02
R1500:Lamb1	UTSW	12	31298949	missense	possibly damaging	0.82
R1624:Lamb1	UTSW	12	31278652	critical splice donor site	probably null
R1772:Lamb1	UTSW	12	31278525	missense	probably damaging	1.00
R1836:Lamb1	UTSW	12	31301094	missense	probably benign	0.00
R1853:Lamb1	UTSW	12	31318272	missense	probably damaging	1.00
R1903:Lamb1	UTSW	12	31329210	missense	probably damaging	1.00
R2091:Lamb1	UTSW	12	31287429	missense	probably damaging	0.98
R2186:Lamb1	UTSW	12	31318467	nonsense	probably null
R2268:Lamb1	UTSW	12	31327645	missense	probably damaging	1.00
R2567:Lamb1	UTSW	12	31269055	critical splice acceptor site	probably null
R2698:Lamb1	UTSW	12	31298883	missense	probably benign	0.10
R3121:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3405:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3406:Lamb1	UTSW	12	31287529	missense	probably damaging	1.00
R3608:Lamb1	UTSW	12	31287910	missense	probably damaging	1.00
R3725:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3726:Lamb1	UTSW	12	31321075	missense	probably null	0.63
R3949:Lamb1	UTSW	12	31282649	missense	probably damaging	1.00
R4308:Lamb1	UTSW	12	31329255	missense	probably damaging	1.00
R4600:Lamb1	UTSW	12	31323529	missense	probably benign	0.00
R4604:Lamb1	UTSW	12	31278776	missense	probably damaging	1.00
R4701:Lamb1	UTSW	12	31266848	nonsense	probably null
R4710:Lamb1	UTSW	12	31282583	missense	probably benign	0.02
R4767:Lamb1	UTSW	12	31308011	missense	probably damaging	1.00
R4809:Lamb1	UTSW	12	31278526	missense	probably damaging	1.00
R4828:Lamb1	UTSW	12	31298930	missense	probably benign
R4842:Lamb1	UTSW	12	31287433	missense	probably damaging	1.00
R4864:Lamb1	UTSW	12	31321006	missense	probably benign	0.01
R4909:Lamb1	UTSW	12	31288281	missense	probably damaging	1.00
R4989:Lamb1	UTSW	12	31326678	missense	probably damaging	1.00
R5444:Lamb1	UTSW	12	31298909	missense	possibly damaging	0.47
R5736:Lamb1	UTSW	12	31302665	nonsense	probably null
R5766:Lamb1	UTSW	12	31299931	missense	probably damaging	1.00
R5825:Lamb1	UTSW	12	31318614	missense	probably benign
R5840:Lamb1	UTSW	12	31266756	missense	probably damaging	1.00
R5867:Lamb1	UTSW	12	31298955	missense	possibly damaging	0.82
R5887:Lamb1	UTSW	12	31266864	nonsense	probably null
R5984:Lamb1	UTSW	12	31327774	missense	possibly damaging	0.76
R6313:Lamb1	UTSW	12	31269147	missense	probably damaging	1.00
R6359:Lamb1	UTSW	12	31282716	missense	probably damaging	0.97
R6505:Lamb1	UTSW	12	31323462	missense	possibly damaging	0.63
R7127:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7202:Lamb1	UTSW	12	31324315	missense	probably damaging	1.00
R7271:Lamb1	UTSW	12	31287424	missense	probably damaging	1.00
R7290:Lamb1	UTSW	12	31265596	missense	probably benign	0.04
R7486:Lamb1	UTSW	12	31287442	missense	probably benign	0.00
R7496:Lamb1	UTSW	12	31300021	missense	probably benign	0.31
R7591:Lamb1	UTSW	12	31326648	missense	probably damaging	1.00
R7722:Lamb1	UTSW	12	31323571	missense	probably damaging	0.99
R7985:Lamb1	UTSW	12	31300215	missense	possibly damaging	0.93
R8058:Lamb1	UTSW	12	31303047	missense	probably benign	0.16
R8353:Lamb1	UTSW	12	31306999	missense	probably damaging	1.00
R8506:Lamb1	UTSW	12	31329361	missense	probably damaging	1.00
R8846:Lamb1	UTSW	12	31329389	missense	possibly damaging	0.75
R8888:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R8895:Lamb1	UTSW	12	31302954	missense	possibly damaging	0.95
R9312:Lamb1	UTSW	12	31318353	missense	probably damaging	1.00
R9340:Lamb1	UTSW	12	31324224	missense	probably benign
R9340:Lamb1	UTSW	12	31324225	missense	probably benign
R9371:Lamb1	UTSW	12	31298864	missense	probably damaging	0.98
R9417:Lamb1	UTSW	12	31287984	missense	probably damaging	1.00
R9562:Lamb1	UTSW	12	31272493	missense	probably damaging	1.00
R9626:Lamb1	UTSW	12	31304670	missense	probably benign
R9641:Lamb1	UTSW	12	31287458	missense	probably damaging	0.97
X0054:Lamb1	UTSW	12	31287434	missense	probably damaging	1.00
X0064:Lamb1	UTSW	12	31303042	missense	probably benign	0.35
Z1176:Lamb1	UTSW	12	31327702	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- AAGATGGGCTCTGGAGATGC -3'
(R):5'- CAATGATAGCATCCCAGAGAGC -3'

Sequencing Primer
(F):5'- AATCATTTCCTGGCTGTGAGAC -3'
(R):5'- TCCCAGAGAGCAAAGCACTGG -3'

Posted On

2014-06-23