Incidental Mutation 'R1854:Lamb1'
ID205958
Institutional Source Beutler Lab
Gene Symbol Lamb1
Ensembl Gene ENSMUSG00000002900
Gene Namelaminin B1
SynonymsC80098, C81607, Lamb1-1, Lamb-1, D130003D08Rik
MMRRC Submission 039878-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1854 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location31265234-31329644 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 31318272 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 1134 (C1134G)
Ref Sequence ENSEMBL: ENSMUSP00000132778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000169088]
PDB Structure Laminin beta1 LN-LE1-4 structure [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000002979
AA Change: C1182G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900
AA Change: C1182G

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
EGF_Lam 558 602 3.4e-8 SMART
EGF_Lam 821 866 4.99e-15 SMART
EGF_Lam 869 912 2.38e-12 SMART
EGF_Lam 915 962 2.4e-8 SMART
EGF_Lam 965 1021 1.41e-5 SMART
EGF_Lam 1024 1073 4.81e-8 SMART
EGF_Lam 1076 1129 3.81e-11 SMART
EGF_Lam 1132 1177 5.61e-9 SMART
EGF_Lam 1180 1224 2.89e-11 SMART
coiled coil region 1329 1360 N/A INTRINSIC
low complexity region 1468 1480 N/A INTRINSIC
coiled coil region 1497 1551 N/A INTRINSIC
coiled coil region 1600 1826 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169088
AA Change: C1134G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900
AA Change: C1134G

DomainStartEndE-ValueType
LamNT 29 269 3.24e-96 SMART
EGF_Lam 271 332 1.34e-6 SMART
EGF_Lam 335 395 1.33e-10 SMART
EGF_Lam 398 455 2.89e-11 SMART
EGF_Lam 458 507 2.89e-11 SMART
EGF_Lam 510 554 3.4e-8 SMART
EGF_Lam 773 818 4.99e-15 SMART
EGF_Lam 821 864 2.38e-12 SMART
EGF_Lam 867 914 2.4e-8 SMART
EGF_Lam 917 973 1.41e-5 SMART
EGF_Lam 976 1025 4.81e-8 SMART
EGF_Lam 1028 1081 3.81e-11 SMART
EGF_Lam 1084 1129 5.61e-9 SMART
EGF_Lam 1132 1176 2.89e-11 SMART
coiled coil region 1281 1312 N/A INTRINSIC
low complexity region 1420 1432 N/A INTRINSIC
coiled coil region 1449 1503 N/A INTRINSIC
coiled coil region 1552 1778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a gene trapped allele lack basement membranes and fail to survive past E5.5. Mice heterozygous for a spontaneous mutation exhibit dystonis with impaired neuron firing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik C T 16: 88,707,780 R43K possibly damaging Het
Acp1 A G 12: 30,897,805 I78T possibly damaging Het
Afap1l1 G T 18: 61,743,294 D417E probably benign Het
Agap2 G A 10: 127,080,516 V299I unknown Het
Ahnak C T 19: 9,013,832 A4160V possibly damaging Het
Anapc1 T C 2: 128,675,890 E278G probably damaging Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
Atg2a A G 19: 6,252,431 E928G probably benign Het
Atp2b2 A C 6: 113,842,283 N16K probably damaging Het
Atp6ap1l T C 13: 90,883,588 E325G probably damaging Het
Bfsp2 C T 9: 103,449,831 G236S probably benign Het
Ccar1 A T 10: 62,764,517 I545N probably damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cdc42bpg A T 19: 6,320,807 H1310L possibly damaging Het
Ces1h T C 8: 93,358,822 K339E probably benign Het
Cit A G 5: 115,873,901 Y189C probably damaging Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Cntrl A G 2: 35,122,684 D278G probably damaging Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Col6a1 T G 10: 76,721,949 Y151S probably damaging Het
Col6a2 T A 10: 76,614,812 Q95L probably damaging Het
Cpd G T 11: 76,786,338 P1185Q probably damaging Het
Cycs T A 6: 50,565,329 I76F possibly damaging Het
Cyp4f16 T A 17: 32,537,099 I34N probably damaging Het
Ddx1 A C 12: 13,229,331 S436A probably benign Het
Defa30 A G 8: 21,135,484 Y88C probably damaging Het
Dhx30 G A 9: 110,088,672 L317F probably damaging Het
Dll3 C A 7: 28,296,410 G322V probably damaging Het
Dnah10 G A 5: 124,804,689 D2843N probably damaging Het
Dnaja3 C T 16: 4,697,269 T266I probably damaging Het
Dpp9 T C 17: 56,202,885 I314V probably benign Het
E030025P04Rik A G 11: 109,143,918 V48A unknown Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Eri3 G A 4: 117,649,365 G297D probably benign Het
Esp34 A G 17: 38,559,533 E38G possibly damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Frzb A G 2: 80,446,380 V154A possibly damaging Het
Fsip2 G T 2: 82,993,257 A6445S possibly damaging Het
Gm11938 G A 11: 99,603,017 T84I possibly damaging Het
Gm4787 T A 12: 81,378,334 H350L probably damaging Het
Gpa33 A G 1: 166,165,190 I291V probably benign Het
Gpr158 A G 2: 21,369,124 Y290C probably damaging Het
Gpsm1 G T 2: 26,344,713 G84W probably damaging Het
Hormad1 A G 3: 95,580,006 N267S probably benign Het
Htr2a A T 14: 74,705,753 I258F probably damaging Het
Htra4 T C 8: 25,033,581 T323A probably damaging Het
Ift140 T A 17: 25,035,839 F162Y probably benign Het
Islr2 T C 9: 58,199,816 T54A probably damaging Het
Kcna4 T G 2: 107,296,484 V521G probably damaging Het
Kdr C T 5: 75,952,905 G768S possibly damaging Het
Kif6 G T 17: 49,901,771 A740S probably benign Het
Lad1 T A 1: 135,827,730 V248E probably damaging Het
Lamc1 A G 1: 153,249,872 Y552H probably damaging Het
Maats1 T C 16: 38,324,297 probably null Het
Mctp1 A T 13: 76,825,741 T706S probably damaging Het
Med12l A G 3: 59,260,772 Y1541C probably damaging Het
Mnx1 C T 5: 29,477,782 S165N unknown Het
Morn3 A T 5: 123,046,629 probably null Het
Nalcn C T 14: 123,460,412 R484Q probably damaging Het
Nr4a1 T C 15: 101,271,764 I305T probably benign Het
Olfr30 G A 11: 58,455,431 R173W probably damaging Het
Olfr339 C T 2: 36,421,874 H159Y probably damaging Het
Pcdhb5 T C 18: 37,322,340 V591A possibly damaging Het
Pdia3 T C 2: 121,431,663 I205T probably benign Het
Pdia4 A T 6: 47,813,227 D26E unknown Het
Phactr3 C A 2: 178,283,147 L292M probably damaging Het
Phf21b T A 15: 84,854,762 I21F probably benign Het
Pign A G 1: 105,554,498 V791A probably damaging Het
Pitpna A G 11: 75,609,103 probably null Het
Piwil1 G T 5: 128,747,839 E534* probably null Het
Plcz1 T A 6: 139,993,049 I526F probably benign Het
Pms2 A T 5: 143,925,896 K607I probably benign Het
Pnn T A 12: 59,071,613 N327K probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Polq C T 16: 37,062,109 T1545I probably benign Het
Psd4 G A 2: 24,397,456 E467K probably benign Het
Pstpip2 T A 18: 77,871,799 L198Q probably damaging Het
Pzp T C 6: 128,502,225 Y655C probably damaging Het
Qrsl1 C T 10: 43,894,545 G117E probably damaging Het
Rad54b G A 4: 11,601,669 C408Y probably damaging Het
Ralb T A 1: 119,476,067 Q110L possibly damaging Het
Rrm2 A G 12: 24,713,152 K218E probably damaging Het
Siglece A G 7: 43,659,936 F66S probably benign Het
Slc17a8 A T 10: 89,606,765 C69S unknown Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Slc38a11 A T 2: 65,363,516 probably null Het
Smarcal1 G A 1: 72,586,099 G135D possibly damaging Het
Snrnp70 T A 7: 45,377,220 R242* probably null Het
St3gal5 T C 6: 72,132,093 L55P probably damaging Het
Sulf1 A G 1: 12,838,437 N558S probably benign Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tas2r113 T A 6: 132,893,329 Y107N probably damaging Het
Tcf7 A G 11: 52,257,064 V187A probably benign Het
Tdrd9 G A 12: 112,044,812 G1152R probably damaging Het
Tfpi A G 2: 84,458,107 Y9H probably benign Het
Tnk2 G A 16: 32,680,142 V758I probably damaging Het
Trim72 A G 7: 128,009,082 I251V probably benign Het
Trip12 T A 1: 84,728,145 N655Y probably damaging Het
Ttn A G 2: 76,751,429 V23040A probably damaging Het
Tulp2 T A 7: 45,517,943 N188K probably damaging Het
Ube2c C T 2: 164,771,362 H67Y probably damaging Het
Unc80 C A 1: 66,631,414 P1899T possibly damaging Het
Usp34 C T 11: 23,426,153 A1879V probably benign Het
Vmn2r118 G A 17: 55,611,556 S112L possibly damaging Het
Wdfy3 A T 5: 101,888,186 V2122E probably benign Het
Zcchc4 A G 5: 52,815,826 Y344C probably damaging Het
Zdbf2 GAAAAA GAAAAAA 1: 63,305,542 probably null Het
Zdhhc25 A T 15: 88,600,486 H8L probably benign Het
Zfp455 A T 13: 67,207,817 H383L probably damaging Het
Zfp663 A G 2: 165,353,291 I336T probably benign Het
Zfp738 T A 13: 67,670,357 H505L probably damaging Het
Zfp84 T G 7: 29,775,371 F23V possibly damaging Het
Other mutations in Lamb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Lamb1 APN 12 31298826 missense possibly damaging 0.74
IGL00939:Lamb1 APN 12 31302927 missense probably damaging 1.00
IGL01017:Lamb1 APN 12 31301064 missense possibly damaging 0.89
IGL01384:Lamb1 APN 12 31320931 missense probably benign 0.09
IGL01470:Lamb1 APN 12 31300262 missense possibly damaging 0.55
IGL01554:Lamb1 APN 12 31306977 missense probably damaging 1.00
IGL02207:Lamb1 APN 12 31329435 missense probably damaging 1.00
IGL02271:Lamb1 APN 12 31300251 missense probably damaging 1.00
IGL02272:Lamb1 APN 12 31305769 missense probably benign 0.00
IGL02365:Lamb1 APN 12 31318345 missense probably damaging 1.00
IGL02471:Lamb1 APN 12 31320908 missense probably damaging 1.00
IGL02704:Lamb1 APN 12 31318467 missense probably benign 0.05
IGL03132:Lamb1 APN 12 31300334 splice site probably null
IGL03161:Lamb1 APN 12 31326256 missense probably benign 0.41
IGL03169:Lamb1 APN 12 31323646 missense probably damaging 1.00
Crush UTSW 12 31287424 missense probably damaging 1.00
Deflationary UTSW 12 31321075 missense probably null 0.63
E0374:Lamb1 UTSW 12 31287930 missense probably damaging 1.00
P0043:Lamb1 UTSW 12 31278621 missense probably damaging 1.00
R0031:Lamb1 UTSW 12 31301156 missense probably benign 0.04
R0047:Lamb1 UTSW 12 31278601 missense possibly damaging 0.51
R0047:Lamb1 UTSW 12 31278601 missense possibly damaging 0.51
R0285:Lamb1 UTSW 12 31326645 nonsense probably null
R0456:Lamb1 UTSW 12 31304730 missense probably damaging 1.00
R0477:Lamb1 UTSW 12 31326269 missense possibly damaging 0.47
R0480:Lamb1 UTSW 12 31282721 missense possibly damaging 0.79
R0544:Lamb1 UTSW 12 31282695 missense probably damaging 1.00
R0565:Lamb1 UTSW 12 31298915 missense probably benign 0.02
R1500:Lamb1 UTSW 12 31298949 missense possibly damaging 0.82
R1624:Lamb1 UTSW 12 31278652 critical splice donor site probably null
R1772:Lamb1 UTSW 12 31278525 missense probably damaging 1.00
R1836:Lamb1 UTSW 12 31301094 missense probably benign 0.00
R1853:Lamb1 UTSW 12 31318272 missense probably damaging 1.00
R1903:Lamb1 UTSW 12 31329210 missense probably damaging 1.00
R2091:Lamb1 UTSW 12 31287429 missense probably damaging 0.98
R2186:Lamb1 UTSW 12 31318467 nonsense probably null
R2268:Lamb1 UTSW 12 31327645 missense probably damaging 1.00
R2567:Lamb1 UTSW 12 31269055 critical splice acceptor site probably null
R2698:Lamb1 UTSW 12 31298883 missense probably benign 0.10
R3121:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3405:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3406:Lamb1 UTSW 12 31287529 missense probably damaging 1.00
R3608:Lamb1 UTSW 12 31287910 missense probably damaging 1.00
R3725:Lamb1 UTSW 12 31321075 missense probably null 0.63
R3726:Lamb1 UTSW 12 31321075 missense probably null 0.63
R3949:Lamb1 UTSW 12 31282649 missense probably damaging 1.00
R4308:Lamb1 UTSW 12 31329255 missense probably damaging 1.00
R4600:Lamb1 UTSW 12 31323529 missense probably benign 0.00
R4604:Lamb1 UTSW 12 31278776 missense probably damaging 1.00
R4701:Lamb1 UTSW 12 31266848 nonsense probably null
R4710:Lamb1 UTSW 12 31282583 missense probably benign 0.02
R4767:Lamb1 UTSW 12 31308011 missense probably damaging 1.00
R4809:Lamb1 UTSW 12 31278526 missense probably damaging 1.00
R4828:Lamb1 UTSW 12 31298930 missense probably benign
R4842:Lamb1 UTSW 12 31287433 missense probably damaging 1.00
R4864:Lamb1 UTSW 12 31321006 missense probably benign 0.01
R4909:Lamb1 UTSW 12 31288281 missense probably damaging 1.00
R4989:Lamb1 UTSW 12 31326678 missense probably damaging 1.00
R5444:Lamb1 UTSW 12 31298909 missense possibly damaging 0.47
R5736:Lamb1 UTSW 12 31302665 nonsense probably null
R5766:Lamb1 UTSW 12 31299931 missense probably damaging 1.00
R5825:Lamb1 UTSW 12 31318614 missense probably benign
R5840:Lamb1 UTSW 12 31266756 missense probably damaging 1.00
R5867:Lamb1 UTSW 12 31298955 missense possibly damaging 0.82
R5887:Lamb1 UTSW 12 31266864 nonsense probably null
R5984:Lamb1 UTSW 12 31327774 missense possibly damaging 0.76
R6313:Lamb1 UTSW 12 31269147 missense probably damaging 1.00
R6359:Lamb1 UTSW 12 31282716 missense probably damaging 0.97
R6505:Lamb1 UTSW 12 31323462 missense possibly damaging 0.63
R7127:Lamb1 UTSW 12 31324315 missense probably damaging 1.00
R7202:Lamb1 UTSW 12 31324315 missense probably damaging 1.00
R7271:Lamb1 UTSW 12 31287424 missense probably damaging 1.00
R7290:Lamb1 UTSW 12 31265596 missense probably benign 0.04
R7486:Lamb1 UTSW 12 31287442 missense probably benign 0.00
R7496:Lamb1 UTSW 12 31300021 missense probably benign 0.31
R7591:Lamb1 UTSW 12 31326648 missense probably damaging 1.00
R7722:Lamb1 UTSW 12 31323571 missense probably damaging 0.99
R7985:Lamb1 UTSW 12 31300215 missense possibly damaging 0.93
R8058:Lamb1 UTSW 12 31303047 missense probably benign 0.16
R8353:Lamb1 UTSW 12 31306999 missense probably damaging 1.00
R8506:Lamb1 UTSW 12 31329361 missense probably damaging 1.00
R8846:Lamb1 UTSW 12 31329389 missense possibly damaging 0.75
R8888:Lamb1 UTSW 12 31302954 missense possibly damaging 0.95
R8895:Lamb1 UTSW 12 31302954 missense possibly damaging 0.95
X0054:Lamb1 UTSW 12 31287434 missense probably damaging 1.00
X0064:Lamb1 UTSW 12 31303042 missense probably benign 0.35
Z1176:Lamb1 UTSW 12 31327702 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AAGATGGGCTCTGGAGATGC -3'
(R):5'- CAATGATAGCATCCCAGAGAGC -3'

Sequencing Primer
(F):5'- AATCATTTCCTGGCTGTGAGAC -3'
(R):5'- TCCCAGAGAGCAAAGCACTGG -3'
Posted On2014-06-23