Incidental Mutation 'R4414:Golim4'
ID328051
Institutional Source Beutler Lab
Gene Symbol Golim4
Ensembl Gene ENSMUSG00000034109
Gene Namegolgi integral membrane protein 4
Synonyms3110027H23Rik, P138, Golph4, GPP130
MMRRC Submission 041694-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R4414 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location75875084-75956949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 75895040 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 287 (N287T)
Ref Sequence ENSEMBL: ENSMUSP00000132910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038563] [ENSMUST00000117242] [ENSMUST00000167078]
Predicted Effect probably benign
Transcript: ENSMUST00000038563
AA Change: N287T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000048997
Gene: ENSMUSG00000034109
AA Change: N287T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
coiled coil region 108 211 N/A INTRINSIC
coiled coil region 295 326 N/A INTRINSIC
coiled coil region 371 402 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
internal_repeat_1 472 524 2.99e-6 PROSPERO
low complexity region 538 550 N/A INTRINSIC
internal_repeat_1 573 618 2.99e-6 PROSPERO
low complexity region 634 641 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117242
AA Change: N315T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114006
Gene: ENSMUSG00000034109
AA Change: N315T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
coiled coil region 108 244 N/A INTRINSIC
coiled coil region 323 354 N/A INTRINSIC
coiled coil region 399 430 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
internal_repeat_1 500 552 7.18e-7 PROSPERO
low complexity region 566 578 N/A INTRINSIC
internal_repeat_1 601 646 7.18e-7 PROSPERO
low complexity region 662 669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134444
Predicted Effect unknown
Transcript: ENSMUST00000150904
AA Change: N81T
SMART Domains Protein: ENSMUSP00000119501
Gene: ENSMUSG00000034109
AA Change: N81T

DomainStartEndE-ValueType
coiled coil region 89 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167078
AA Change: N287T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000132910
Gene: ENSMUSG00000034109
AA Change: N287T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
coiled coil region 108 211 N/A INTRINSIC
coiled coil region 295 326 N/A INTRINSIC
coiled coil region 371 402 N/A INTRINSIC
low complexity region 432 442 N/A INTRINSIC
internal_repeat_1 472 524 2.99e-6 PROSPERO
low complexity region 538 550 N/A INTRINSIC
internal_repeat_1 573 618 2.99e-6 PROSPERO
low complexity region 634 641 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi-resident protein. It may process proteins synthesized in the rough endoplasmic reticulum and assist in the transport of protein cargo through the Golgi apparatus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Aco2 A G 15: 81,889,383 probably null Het
Acss1 A G 2: 150,659,903 S115P possibly damaging Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cep89 A G 7: 35,416,397 probably benign Het
Cfap58 A G 19: 47,953,041 K283E possibly damaging Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Dse A T 10: 34,152,636 F819L probably benign Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Iqgap3 G T 3: 88,096,986 V460F probably benign Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mapk4 A T 18: 73,930,538 F538I possibly damaging Het
Mlxipl A G 5: 135,137,399 probably benign Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Obsl1 A T 1: 75,490,902 D1409E probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in Golim4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Golim4 APN 3 75886311 missense probably damaging 1.00
IGL01540:Golim4 APN 3 75886740 missense possibly damaging 0.81
IGL01548:Golim4 APN 3 75908125 splice site probably null
IGL01552:Golim4 APN 3 75956195 missense probably damaging 1.00
IGL02218:Golim4 APN 3 75878054 missense probably damaging 1.00
IGL02935:Golim4 APN 3 75894992 missense possibly damaging 0.86
IGL03087:Golim4 APN 3 75878673 missense possibly damaging 0.94
R1314:Golim4 UTSW 3 75886288 missense probably damaging 1.00
R1436:Golim4 UTSW 3 75878644 critical splice donor site probably null
R1438:Golim4 UTSW 3 75956133 missense probably damaging 0.99
R1686:Golim4 UTSW 3 75895136 missense probably benign 0.00
R1785:Golim4 UTSW 3 75908149 missense probably damaging 1.00
R1786:Golim4 UTSW 3 75908149 missense probably damaging 1.00
R1828:Golim4 UTSW 3 75902438 missense probably damaging 1.00
R2057:Golim4 UTSW 3 75894887 missense possibly damaging 0.62
R2130:Golim4 UTSW 3 75908149 missense probably damaging 1.00
R2131:Golim4 UTSW 3 75908149 missense probably damaging 1.00
R2133:Golim4 UTSW 3 75908149 missense probably damaging 1.00
R2432:Golim4 UTSW 3 75891942 missense possibly damaging 0.93
R2517:Golim4 UTSW 3 75892859 missense probably benign 0.01
R3915:Golim4 UTSW 3 75903327 missense probably damaging 1.00
R4976:Golim4 UTSW 3 75878643 splice site probably null
R5102:Golim4 UTSW 3 75903272 missense possibly damaging 0.87
R5619:Golim4 UTSW 3 75906495 nonsense probably null
R7051:Golim4 UTSW 3 75893002 missense probably benign 0.07
R7058:Golim4 UTSW 3 75878650 missense probably damaging 1.00
R7303:Golim4 UTSW 3 75878053 missense probably damaging 1.00
R7702:Golim4 UTSW 3 75886784 missense probably damaging 1.00
X0062:Golim4 UTSW 3 75906419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGTGGGCTGCATTCTG -3'
(R):5'- AGACTCCGGGATTTTGCTTC -3'

Sequencing Primer
(F):5'- GGGCTGCATTCTGTCCCTG -3'
(R):5'- GCCCTTTTAGATGAGGTAATAGAAGC -3'
Posted On2015-07-07