Incidental Mutation 'R4414:Aco2'
ID328079
Institutional Source Beutler Lab
Gene Symbol Aco2
Ensembl Gene ENSMUSG00000022477
Gene Nameaconitase 2, mitochondrial
SynonymsAco-2, Aco3, D10Wsu183e
MMRRC Submission 041694-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R4414 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location81872309-81915133 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 81889383 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023116] [ENSMUST00000135198] [ENSMUST00000157003] [ENSMUST00000229068] [ENSMUST00000231091]
Predicted Effect probably benign
Transcript: ENSMUST00000023116
AA Change: E41G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023116
Gene: ENSMUSG00000022477
AA Change: E41G

DomainStartEndE-ValueType
Pfam:Aconitase 65 503 2.2e-160 PFAM
Pfam:Aconitase_C 582 712 5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135198
AA Change: E41G

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably null
Transcript: ENSMUST00000157003
Predicted Effect probably benign
Transcript: ENSMUST00000229068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230669
Predicted Effect probably benign
Transcript: ENSMUST00000231091
AA Change: E8G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0857 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aconitase/IPM isomerase family. It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA cycle. This protein is encoded in the nucleus and functions in the mitochondrion. It was found to be one of the mitochondrial matrix proteins that are preferentially degraded by the serine protease 15(PRSS15), also known as Lon protease, after oxidative modification. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T C 4: 41,505,574 T183A possibly damaging Het
4930503E14Rik T A 14: 44,169,233 M120L probably benign Het
Acss1 A G 2: 150,659,903 S115P possibly damaging Het
Ank2 A T 3: 127,225,762 probably null Het
AU041133 C T 10: 82,151,482 T323M probably damaging Het
Bdp1 T C 13: 100,030,861 D2215G probably damaging Het
Bod1l G A 5: 41,820,527 T1148I probably benign Het
Celsr1 C T 15: 85,963,133 V1468I probably benign Het
Celsr1 A G 15: 85,927,999 V2065A probably damaging Het
Cep89 A G 7: 35,416,397 probably benign Het
Cfap58 A G 19: 47,953,041 K283E possibly damaging Het
Cog5 C T 12: 31,660,854 Q78* probably null Het
Col20a1 C T 2: 181,001,250 R796C possibly damaging Het
Dnah7b A T 1: 46,126,680 T502S probably benign Het
Dnm1l A G 16: 16,342,695 probably null Het
Dse A T 10: 34,152,636 F819L probably benign Het
Eloa G T 4: 136,011,242 L136I possibly damaging Het
Eloa T A 4: 136,011,265 H128L probably benign Het
Fbxl6 T C 15: 76,537,724 E205G possibly damaging Het
Golim4 T G 3: 75,895,040 N287T probably benign Het
Gpx8 T A 13: 113,043,148 K206N possibly damaging Het
Iqgap3 G T 3: 88,096,986 V460F probably benign Het
Kcne4 A T 1: 78,817,934 M100L probably benign Het
Kmt2a A T 9: 44,809,780 probably benign Het
Ktn1 G A 14: 47,724,930 W1117* probably null Het
Lad1 A G 1: 135,828,746 D364G probably benign Het
Lmln T G 16: 33,109,850 I559S probably benign Het
Mapk4 A T 18: 73,930,538 F538I possibly damaging Het
Mlxipl A G 5: 135,137,399 probably benign Het
Mmrn1 T C 6: 60,944,586 L9P probably damaging Het
Mnat1 G A 12: 73,181,827 R155H probably damaging Het
Mtmr11 T C 3: 96,167,891 probably benign Het
Naaladl1 T C 19: 6,115,551 L745P probably damaging Het
Obsl1 A T 1: 75,490,902 D1409E probably benign Het
Oit3 T C 10: 59,428,103 Y403C probably damaging Het
Pla2g4e A T 2: 120,182,713 H375Q probably benign Het
Prodh2 G A 7: 30,506,452 V238M probably damaging Het
Rdh14 G A 12: 10,391,231 probably null Het
Rho G A 6: 115,935,230 V76I probably benign Het
Rock1 A T 18: 10,080,514 M1010K probably damaging Het
Ros1 A G 10: 52,162,704 probably null Het
Sim1 A T 10: 50,981,612 D486V probably benign Het
Src A G 2: 157,464,653 D192G probably damaging Het
Stox1 T C 10: 62,659,569 N975S probably benign Het
Tmem145 A G 7: 25,307,129 Y54C probably damaging Het
Try4 C T 6: 41,304,971 P164S possibly damaging Het
Vegfc A T 8: 54,181,095 N270Y probably benign Het
Other mutations in Aco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Aco2 APN 15 81913714 missense possibly damaging 0.88
IGL02450:Aco2 APN 15 81914762 makesense probably null
IGL03408:Aco2 APN 15 81899223 critical splice donor site probably null
ANU22:Aco2 UTSW 15 81913714 missense possibly damaging 0.88
R0066:Aco2 UTSW 15 81903465 splice site probably benign
R0066:Aco2 UTSW 15 81903465 splice site probably benign
R0254:Aco2 UTSW 15 81889356 missense probably damaging 0.99
R0408:Aco2 UTSW 15 81913118 unclassified probably null
R0535:Aco2 UTSW 15 81913217 missense possibly damaging 0.76
R0839:Aco2 UTSW 15 81907535 splice site probably null
R1199:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1201:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1320:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1321:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R1322:Aco2 UTSW 15 81895193 missense probably damaging 1.00
R2082:Aco2 UTSW 15 81913695 missense possibly damaging 0.83
R2275:Aco2 UTSW 15 81895264 missense probably benign 0.37
R2297:Aco2 UTSW 15 81903908 missense probably damaging 1.00
R4497:Aco2 UTSW 15 81895285 missense probably damaging 1.00
R4498:Aco2 UTSW 15 81895285 missense probably damaging 1.00
R4708:Aco2 UTSW 15 81909916 critical splice donor site probably null
R5556:Aco2 UTSW 15 81889319 missense probably damaging 1.00
R5568:Aco2 UTSW 15 81903586 missense probably damaging 0.99
R6103:Aco2 UTSW 15 81913251 missense probably benign 0.00
R6912:Aco2 UTSW 15 81895396 missense probably benign
R7319:Aco2 UTSW 15 81903619 missense probably damaging 1.00
R7552:Aco2 UTSW 15 81903941 missense probably damaging 1.00
R7585:Aco2 UTSW 15 81872484 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCTACAGTCACATAACAGCTCATG -3'
(R):5'- AAGTGTAGGCTTCACCAGTC -3'

Sequencing Primer
(F):5'- GTCACATAACAGCTCATGACACCTG -3'
(R):5'- GTGTAGGCTTCACCAGTCAACAG -3'
Posted On2015-07-07