Incidental Mutation 'R4452:Olfr1099'
ID328996
Institutional Source Beutler Lab
Gene Symbol Olfr1099
Ensembl Gene ENSMUSG00000075168
Gene Nameolfactory receptor 1099
SynonymsMOR206-3, GA_x6K02T2Q125-48446067-48445129
MMRRC Submission 041713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R4452 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86955126-86960693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86958699 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 253 (G253D)
Ref Sequence ENSEMBL: ENSMUSP00000149528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099871] [ENSMUST00000213456]
Predicted Effect probably damaging
Transcript: ENSMUST00000099871
AA Change: G253D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097456
Gene: ENSMUSG00000075168
AA Change: G253D

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.9e-54 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213456
AA Change: G253D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 A G 7: 119,698,574 T145A possibly damaging Het
Adgra1 G T 7: 139,852,521 A92S probably benign Het
Aim2 A G 1: 173,455,444 T31A possibly damaging Het
Cd46 G A 1: 195,085,360 A131V possibly damaging Het
Cdc27 A T 11: 104,517,395 M563K probably benign Het
Chd9 A T 8: 90,977,680 N721I probably damaging Het
Cnn2 A G 10: 79,991,442 D49G probably benign Het
Cul1 T A 6: 47,508,989 Y323* probably null Het
D5Ertd579e A G 5: 36,616,470 W194R probably damaging Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Dnah9 C T 11: 66,027,082 A2249T probably damaging Het
Dppa4 T A 16: 48,289,336 D106E probably benign Het
Gja10 A G 4: 32,601,313 V357A probably benign Het
Gm20481 T G 17: 34,972,133 probably benign Het
Grxcr2 T C 18: 41,986,544 N244D probably damaging Het
Klk1b11 T A 7: 43,995,911 F3I probably damaging Het
Mid1 T C X: 169,927,425 V139A possibly damaging Het
Mycbp2 T C 14: 103,155,658 K3046E probably damaging Het
Nfasc T C 1: 132,634,671 N122S probably damaging Het
Olfr1232 T A 2: 89,325,253 D309V possibly damaging Het
Olfr556 T C 7: 102,670,049 V43A probably benign Het
Olfr655 T A 7: 104,596,639 M181L probably damaging Het
Olfr736 A T 14: 50,392,912 Y52F probably benign Het
Olfr933 T C 9: 38,976,086 S137P probably benign Het
P2ry10b C T X: 107,171,118 T28I probably damaging Het
Pdxdc1 T C 16: 13,837,126 Y675C possibly damaging Het
Plcl1 A G 1: 55,696,886 N462S probably benign Het
Ptf1a G T 2: 19,446,281 A141S possibly damaging Het
Pzp A G 6: 128,491,240 L1028P probably damaging Het
Qrsl1 A G 10: 43,882,162 S312P probably damaging Het
Sars2 A G 7: 28,750,093 T349A probably benign Het
Scarb1 A T 5: 125,300,345 F208I probably damaging Het
Scn8a A G 15: 100,957,091 N153S possibly damaging Het
Sema4c A T 1: 36,553,756 V127D probably benign Het
Smg6 C G 11: 74,990,141 S931C probably benign Het
Trpm2 A T 10: 77,923,593 L1119Q probably damaging Het
Ubtd2 T A 11: 32,499,406 N84K probably damaging Het
Ugt2b35 A T 5: 87,003,378 H281L probably damaging Het
Umodl1 T C 17: 30,994,815 probably null Het
Other mutations in Olfr1099
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Olfr1099 APN 2 86958921 missense possibly damaging 0.90
IGL01624:Olfr1099 APN 2 86959230 missense probably benign 0.05
IGL02119:Olfr1099 APN 2 86959183 missense probably benign 0.24
IGL02433:Olfr1099 APN 2 86959048 missense possibly damaging 0.63
IGL02646:Olfr1099 APN 2 86959353 missense probably damaging 1.00
IGL02824:Olfr1099 APN 2 86958993 missense probably benign 0.03
IGL03228:Olfr1099 APN 2 86958706 missense probably benign 0.16
R0208:Olfr1099 UTSW 2 86959404 missense probably damaging 0.96
R0521:Olfr1099 UTSW 2 86958846 missense probably damaging 1.00
R0783:Olfr1099 UTSW 2 86958562 missense probably benign
R1706:Olfr1099 UTSW 2 86959080 missense probably damaging 1.00
R1859:Olfr1099 UTSW 2 86959081 missense probably damaging 0.99
R2046:Olfr1099 UTSW 2 86958733 missense possibly damaging 0.75
R2126:Olfr1099 UTSW 2 86959098 missense possibly damaging 0.63
R2140:Olfr1099 UTSW 2 86959281 missense probably damaging 1.00
R4680:Olfr1099 UTSW 2 86959321 missense possibly damaging 0.87
R4958:Olfr1099 UTSW 2 86959105 missense possibly damaging 0.75
R4970:Olfr1099 UTSW 2 86959354 missense probably damaging 1.00
R5112:Olfr1099 UTSW 2 86959354 missense probably damaging 1.00
R5532:Olfr1099 UTSW 2 86958580 nonsense probably null
R5691:Olfr1099 UTSW 2 86959272 missense probably damaging 1.00
R6851:Olfr1099 UTSW 2 86959267 missense possibly damaging 0.46
R6858:Olfr1099 UTSW 2 86958690 missense probably benign 0.11
R7368:Olfr1099 UTSW 2 86959258 missense probably damaging 1.00
Z1088:Olfr1099 UTSW 2 86958666 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGGAATTCTAATTCTCTGTTGCTG -3'
(R):5'- TGCAGCAACACACATGATATTG -3'

Sequencing Primer
(F):5'- TGACCTTTGGCATAATTGTTACC -3'
(R):5'- GCAGCAACACACATGATATTGAATTC -3'
Posted On2015-07-21