Incidental Mutation 'R7368:Olfr1099'
ID571912
Institutional Source Beutler Lab
Gene Symbol Olfr1099
Ensembl Gene ENSMUSG00000075168
Gene Nameolfactory receptor 1099
SynonymsMOR206-3, GA_x6K02T2Q125-48446067-48445129
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R7368 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86955126-86960693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86959258 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 67 (S67P)
Ref Sequence ENSEMBL: ENSMUSP00000149528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099871] [ENSMUST00000213456]
Predicted Effect probably damaging
Transcript: ENSMUST00000099871
AA Change: S67P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097456
Gene: ENSMUSG00000075168
AA Change: S67P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.9e-54 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213456
AA Change: S67P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,612,865 F153I possibly damaging Het
Adcy1 G A 11: 7,144,765 V564I probably damaging Het
Apol9b T C 15: 77,735,934 I310T possibly damaging Het
Arhgef28 C A 13: 97,996,862 V366F probably benign Het
B020004C17Rik C T 14: 57,017,316 T199I possibly damaging Het
Carmil2 C T 8: 105,690,835 T575I possibly damaging Het
Catsper1 A T 19: 5,336,663 Q308L unknown Het
Cpa2 T A 6: 30,551,990 S239T probably damaging Het
Ddit3 G A 10: 127,295,907 G108D probably damaging Het
Dnah3 T C 7: 120,029,016 I1473V probably benign Het
Dscam A G 16: 96,643,931 V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 105,888,405 probably benign Het
Ednrb T A 14: 103,820,017 I370F probably benign Het
Ehd3 A G 17: 73,827,462 E272G possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam49b A T 15: 63,938,658 probably null Het
Fkbp11 T C 15: 98,724,426 K189E unknown Het
Frem1 T A 4: 82,966,144 E1190D probably benign Het
Gabrg2 A C 11: 41,976,563 Y76* probably null Het
Gm11437 T A 11: 84,167,472 probably benign Het
Gm8947 C A 1: 151,193,096 Q227K probably benign Het
Gm9195 A G 14: 72,480,056 F279S probably damaging Het
Gpbp1l1 T C 4: 116,573,458 I42T probably benign Het
Hdac5 A T 11: 102,197,381 V939E probably null Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kitl A T 10: 100,016,081 I21F probably benign Het
Krt1 T C 15: 101,846,872 D484G probably damaging Het
Larp1 C A 11: 58,048,078 P527T probably damaging Het
Lrp5 A G 19: 3,620,085 V673A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mmp27 G A 9: 7,577,317 V228M probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 G T 11: 60,490,915 probably null Het
Myt1 A G 2: 181,782,591 K26E possibly damaging Het
Nek1 T A 8: 61,089,707 I777N probably benign Het
Nlrc5 C T 8: 94,476,393 R374* probably null Het
Nol8 T C 13: 49,661,219 S268P probably benign Het
Nynrin T A 14: 55,870,511 L1025Q probably damaging Het
Osbpl3 A T 6: 50,348,098 L140H probably damaging Het
Pcnt T C 10: 76,400,001 N1382S probably benign Het
Pef1 T A 4: 130,127,385 L244* probably null Het
Phf11a T C 14: 59,280,725 E191G probably benign Het
Polr3a A T 14: 24,467,076 D702E probably damaging Het
Ptch1 C T 13: 63,511,984 G1285D probably benign Het
Ptpn3 T C 4: 57,221,993 D566G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Scgb1b12 T C 7: 32,334,567 I84T probably damaging Het
Sh2b1 A T 7: 126,468,513 D618E possibly damaging Het
Slc35f5 T A 1: 125,584,519 V352E probably damaging Het
Sppl2c A G 11: 104,187,604 E410G probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stra6 G A 9: 58,151,260 R468Q probably benign Het
Taf3 T C 2: 9,916,377 H924R unknown Het
Tbx18 C A 9: 87,730,697 V50L probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Unc45b C T 11: 82,942,495 T845I probably benign Het
Usp15 T C 10: 123,196,893 D8G possibly damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Vps13c C A 9: 67,914,073 D1288E probably benign Het
Zfp458 T A 13: 67,257,236 M380L probably benign Het
Zfp638 A G 6: 83,929,455 N201D possibly damaging Het
Other mutations in Olfr1099
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Olfr1099 APN 2 86958921 missense possibly damaging 0.90
IGL01624:Olfr1099 APN 2 86959230 missense probably benign 0.05
IGL02119:Olfr1099 APN 2 86959183 missense probably benign 0.24
IGL02433:Olfr1099 APN 2 86959048 missense possibly damaging 0.63
IGL02646:Olfr1099 APN 2 86959353 missense probably damaging 1.00
IGL02824:Olfr1099 APN 2 86958993 missense probably benign 0.03
IGL03228:Olfr1099 APN 2 86958706 missense probably benign 0.16
R0208:Olfr1099 UTSW 2 86959404 missense probably damaging 0.96
R0521:Olfr1099 UTSW 2 86958846 missense probably damaging 1.00
R0783:Olfr1099 UTSW 2 86958562 missense probably benign
R1706:Olfr1099 UTSW 2 86959080 missense probably damaging 1.00
R1859:Olfr1099 UTSW 2 86959081 missense probably damaging 0.99
R2046:Olfr1099 UTSW 2 86958733 missense possibly damaging 0.75
R2126:Olfr1099 UTSW 2 86959098 missense possibly damaging 0.63
R2140:Olfr1099 UTSW 2 86959281 missense probably damaging 1.00
R4452:Olfr1099 UTSW 2 86958699 missense probably damaging 0.99
R4680:Olfr1099 UTSW 2 86959321 missense possibly damaging 0.87
R4958:Olfr1099 UTSW 2 86959105 missense possibly damaging 0.75
R4970:Olfr1099 UTSW 2 86959354 missense probably damaging 1.00
R5112:Olfr1099 UTSW 2 86959354 missense probably damaging 1.00
R5532:Olfr1099 UTSW 2 86958580 nonsense probably null
R5691:Olfr1099 UTSW 2 86959272 missense probably damaging 1.00
R6851:Olfr1099 UTSW 2 86959267 missense possibly damaging 0.46
R6858:Olfr1099 UTSW 2 86958690 missense probably benign 0.11
Z1088:Olfr1099 UTSW 2 86958666 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGTTTGCAGATAGCTACATACC -3'
(R):5'- GGGTAGTTTGCAATGAATACCTTG -3'

Sequencing Primer
(F):5'- TACCGATCATAGGCCATTGAAG -3'
(R):5'- ATACATTTAAGCCTGATTTCATCCTC -3'
Posted On2019-09-13