Incidental Mutation 'R4470:Tbx4'
ID329386
Institutional Source Beutler Lab
Gene Symbol Tbx4
Ensembl Gene ENSMUSG00000000094
Gene NameT-box 4
Synonyms
MMRRC Submission 041727-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4470 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location85886422-85916097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85912122 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 275 (I275V)
Ref Sequence ENSEMBL: ENSMUSP00000103682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000096] [ENSMUST00000108045] [ENSMUST00000108047]
Predicted Effect probably damaging
Transcript: ENSMUST00000000096
AA Change: I275V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000096
Gene: ENSMUSG00000000094
AA Change: I275V

DomainStartEndE-ValueType
TBOX 71 261 1.15e-126 SMART
Blast:TBOX 302 495 1e-122 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108045
AA Change: I175V

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103680
Gene: ENSMUSG00000000094
AA Change: I175V

DomainStartEndE-ValueType
TBOX 1 161 5e-86 SMART
Blast:TBOX 202 395 1e-122 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000108047
AA Change: I275V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103682
Gene: ENSMUSG00000000094
AA Change: I275V

DomainStartEndE-ValueType
TBOX 71 261 1.15e-126 SMART
Blast:TBOX 302 495 1e-122 BLAST
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is the human homolog of mouse Tbx4, which is closely linked to Tbx2 on mouse chromosome 11. Similarly this gene, like TBX2, maps to human chromosome 17. Expression studies in mouse and chicken show that Tbx4 is expressed in developing hindlimb, but not in forelimb buds, suggesting a role for this gene in regulating limb development and specification of limb identity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit stunted, apoptotic allantoises lacking vascular remodeling, fail to undergo chorioallantoic fusion, lack hindlimb buds, and die by embryonic day 10.5. Heterozygotes show mildly impaired allantois growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,798,516 V258G possibly damaging Het
Adcy1 A G 11: 7,144,804 T577A probably benign Het
Adgb T C 10: 10,398,951 N728S probably benign Het
Alpk1 A G 3: 127,679,526 S943P probably damaging Het
Ankdd1a T C 9: 65,503,509 D398G probably damaging Het
Asah1 A G 8: 41,343,724 probably null Het
Atp13a1 T C 8: 69,798,679 S495P probably damaging Het
Camta2 T C 11: 70,680,940 D510G probably damaging Het
Cdh8 T A 8: 99,416,689 probably benign Het
Cul9 C T 17: 46,538,336 A628T probably benign Het
Ddx19a A G 8: 110,976,479 V442A probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah7c T A 1: 46,748,635 S3283T possibly damaging Het
Fmo9 T A 1: 166,680,230 I19F probably damaging Het
Gmeb2 A T 2: 181,265,145 probably null Het
H2-K1 G A 17: 34,000,061 R23C probably benign Het
Icam5 T A 9: 21,035,506 C443* probably null Het
Il16 A G 7: 83,650,838 probably benign Het
Kcnj3 A T 2: 55,437,865 H222L probably damaging Het
Lama4 T A 10: 39,080,496 Y1138* probably null Het
Lpin3 A G 2: 160,895,434 T134A probably benign Het
Man1b1 C G 2: 25,332,855 probably benign Het
Msc G C 1: 14,755,678 P24R probably damaging Het
Mylk A G 16: 34,912,152 K601E probably benign Het
Myzap A G 9: 71,592,281 probably benign Het
Ncor2 A T 5: 125,102,641 probably null Het
Nrxn3 T C 12: 90,204,741 S276P probably damaging Het
Olfr1219 T C 2: 89,075,038 N18D probably benign Het
Olfr1428 T C 19: 12,109,183 probably null Het
Olfr26 T C 9: 38,855,631 S190P probably damaging Het
Olfr345 T C 2: 36,640,221 F61L probably damaging Het
Olfr66 G A 7: 103,881,749 P165S probably benign Het
Olfr771 G A 10: 129,160,514 L157F probably benign Het
Olfr891 A G 9: 38,180,370 M151T probably damaging Het
Pramel5 T C 4: 144,271,345 K443E possibly damaging Het
Rock2 C T 12: 16,971,275 Q1019* probably null Het
Rps18-ps3 T A 8: 107,263,130 noncoding transcript Het
Sis T C 3: 72,928,159 probably null Het
Slc22a21 T A 11: 53,956,013 I345F probably benign Het
Sox5 A G 6: 143,844,765 M523T possibly damaging Het
Taf1c T C 8: 119,599,622 K526R probably benign Het
Taf2 T C 15: 55,058,880 D337G possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmem9 A G 1: 136,027,496 T123A probably benign Het
Trim69 A G 2: 122,178,599 Y380C probably damaging Het
Vldlr G T 19: 27,234,819 V78L probably damaging Het
Vmn1r68 A T 7: 10,527,348 N274K probably benign Het
Vmn2r104 G T 17: 20,042,241 S209Y probably damaging Het
Vmn2r108 T A 17: 20,462,728 N738I probably damaging Het
Wnt3 A G 11: 103,812,624 D311G probably damaging Het
Yme1l1 T C 2: 23,186,332 probably null Het
Zcchc14 C T 8: 121,651,759 probably benign Het
Zfp148 T C 16: 33,496,232 Y383H probably damaging Het
Zfp41 A G 15: 75,618,519 R107G probably damaging Het
Other mutations in Tbx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Tbx4 APN 11 85911943 missense probably damaging 1.00
IGL02113:Tbx4 APN 11 85912264 missense possibly damaging 0.82
IGL02172:Tbx4 APN 11 85914563 missense possibly damaging 0.83
IGL02440:Tbx4 APN 11 85890894 missense probably damaging 1.00
IGL02889:Tbx4 APN 11 85899795 nonsense probably null
IGL03380:Tbx4 APN 11 85914639 missense probably benign 0.00
R0332:Tbx4 UTSW 11 85898530 missense probably benign 0.06
R1772:Tbx4 UTSW 11 85911207 missense probably damaging 0.96
R1829:Tbx4 UTSW 11 85911920 intron probably null
R1907:Tbx4 UTSW 11 85914523 missense possibly damaging 0.79
R5484:Tbx4 UTSW 11 85914404 missense probably damaging 0.99
R5540:Tbx4 UTSW 11 85911168 missense possibly damaging 0.94
R6962:Tbx4 UTSW 11 85890259 missense probably benign 0.01
R7355:Tbx4 UTSW 11 85912009 missense probably damaging 1.00
X0027:Tbx4 UTSW 11 85914383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCACCCAGCTGAAAATTGAG -3'
(R):5'- GCTTCAGGCAGTGGTAGAAG -3'

Sequencing Primer
(F):5'- ATTGAGAACAACCCTTTTGCCAAGG -3'
(R):5'- TAGAAGAGGCTGGAGTCCCTCTG -3'
Posted On2015-07-21