Incidental Mutation 'R4559:Tgoln1'
ID 342982
Institutional Source Beutler Lab
Gene Symbol Tgoln1
Ensembl Gene ENSMUSG00000056429
Gene Name trans-golgi network protein
Synonyms TGN38A, Ttgn1, D6Ertd384e, TGN38
MMRRC Submission 041785-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R4559 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 72585415-72593983 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72592664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 272 (E272G)
Ref Sequence ENSEMBL: ENSMUSP00000068487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070524]
AlphaFold Q62313
Predicted Effect probably damaging
Transcript: ENSMUST00000070524
AA Change: E272G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068487
Gene: ENSMUSG00000056429
AA Change: E272G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 58 74 N/A INTRINSIC
low complexity region 238 260 N/A INTRINSIC
transmembrane domain 300 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172588
Meta Mutation Damage Score 0.2809 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,567,240 (GRCm39) noncoding transcript Het
1700066M21Rik T C 1: 57,422,083 (GRCm39) F153S possibly damaging Het
Acss1 A G 2: 150,480,405 (GRCm39) V222A probably benign Het
Atad2b A G 12: 4,993,223 (GRCm39) I247M probably benign Het
Atxn10 A G 15: 85,322,321 (GRCm39) I398V possibly damaging Het
Cep192 T A 18: 68,004,584 (GRCm39) C2312S probably damaging Het
Cidea C T 18: 67,493,298 (GRCm39) Q106* probably null Het
Cnga4 A G 7: 105,054,892 (GRCm39) T159A probably damaging Het
Cyp2j12 G T 4: 96,001,194 (GRCm39) S304R probably damaging Het
Dennd2b A G 7: 109,124,785 (GRCm39) F665L probably damaging Het
Dsg4 T A 18: 20,603,978 (GRCm39) V815E probably damaging Het
Entrep1 G A 19: 24,007,913 (GRCm39) S130L probably damaging Het
Farp1 T C 14: 121,510,213 (GRCm39) M737T probably damaging Het
Fbn1 T A 2: 125,193,634 (GRCm39) D1395V possibly damaging Het
Fbn2 C T 18: 58,209,146 (GRCm39) M1076I probably benign Het
Fitm2 T A 2: 163,314,593 (GRCm39) probably benign Het
Fras1 A G 5: 96,929,148 (GRCm39) R3851G probably damaging Het
Frem2 C T 3: 53,561,742 (GRCm39) V922I probably benign Het
Gm10719 A T 9: 3,018,945 (GRCm39) T200S probably benign Het
Grin3a T C 4: 49,844,555 (GRCm39) D176G probably damaging Het
Hdac5 T C 11: 102,089,928 (GRCm39) probably benign Het
Ift140 C A 17: 25,309,741 (GRCm39) H1090Q probably damaging Het
Il20ra A G 10: 19,625,032 (GRCm39) T104A probably damaging Het
Il22ra2 A G 10: 19,502,460 (GRCm39) D93G possibly damaging Het
Ing1 A G 8: 11,612,090 (GRCm39) K176R probably benign Het
Jph1 A T 1: 17,074,735 (GRCm39) C428S probably benign Het
Kif13b G T 14: 65,043,581 (GRCm39) G1794W probably damaging Het
Map10 A G 8: 126,398,553 (GRCm39) T649A probably benign Het
Med12l T C 3: 58,914,523 (GRCm39) probably null Het
Nat8f1 A G 6: 85,887,567 (GRCm39) I131T probably benign Het
Oas1d C A 5: 121,054,958 (GRCm39) Q177K probably benign Het
Or4a74 C A 2: 89,440,043 (GRCm39) M134I probably damaging Het
Or51q1 G A 7: 103,628,767 (GRCm39) D123N probably damaging Het
P2ry2 A G 7: 100,647,363 (GRCm39) V314A possibly damaging Het
Pabir2 G A X: 52,349,554 (GRCm39) probably benign Het
Pfkl G T 10: 77,824,717 (GRCm39) R691S probably benign Het
Plb1 T A 5: 32,490,175 (GRCm39) I1005N probably damaging Het
Prkacb A G 3: 146,451,147 (GRCm39) probably benign Het
Ptprm A T 17: 66,990,403 (GRCm39) Y1412N possibly damaging Het
Rab22a A G 2: 173,503,226 (GRCm39) D13G probably damaging Het
Rab29 G A 1: 131,800,305 (GRCm39) W201* probably null Het
Rasa3 T C 8: 13,648,259 (GRCm39) E135G probably damaging Het
Rassf10 A G 7: 112,554,338 (GRCm39) E313G probably benign Het
Sf1 GGCAGCAGCAGCAGCAGCAGC GGCAGCAGCAGCAGCAGC 19: 6,424,845 (GRCm39) probably benign Het
Sipa1l3 A T 7: 29,031,678 (GRCm39) L468Q probably damaging Het
Slc17a1 A T 13: 24,062,695 (GRCm39) K254* probably null Het
Slc6a12 G A 6: 121,340,820 (GRCm39) probably null Het
Slfn8 A G 11: 82,895,570 (GRCm39) L412P probably damaging Het
Taf4b T C 18: 14,946,583 (GRCm39) S469P probably damaging Het
Tlr12 C A 4: 128,509,563 (GRCm39) G896W probably damaging Het
Tnfrsf1a A G 6: 125,337,729 (GRCm39) I229V probably benign Het
Ttn G A 2: 76,749,890 (GRCm39) H3720Y probably benign Het
Other mutations in Tgoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Tgoln1 APN 6 72,593,073 (GRCm39) missense probably benign 0.00
IGL00795:Tgoln1 APN 6 72,593,235 (GRCm39) missense probably benign 0.01
IGL03002:Tgoln1 APN 6 72,593,055 (GRCm39) missense possibly damaging 0.83
IGL03136:Tgoln1 APN 6 72,591,096 (GRCm39) missense probably damaging 1.00
FR4340:Tgoln1 UTSW 6 72,593,334 (GRCm39) small insertion probably benign
R0684:Tgoln1 UTSW 6 72,592,974 (GRCm39) missense probably benign 0.00
R1656:Tgoln1 UTSW 6 72,591,068 (GRCm39) missense probably damaging 0.99
R1920:Tgoln1 UTSW 6 72,593,084 (GRCm39) missense probably benign 0.01
R2057:Tgoln1 UTSW 6 72,592,653 (GRCm39) missense probably benign 0.35
R4097:Tgoln1 UTSW 6 72,592,784 (GRCm39) missense probably damaging 0.98
R4995:Tgoln1 UTSW 6 72,593,123 (GRCm39) missense possibly damaging 0.92
R5566:Tgoln1 UTSW 6 72,593,018 (GRCm39) missense possibly damaging 0.92
R6224:Tgoln1 UTSW 6 72,592,984 (GRCm39) missense possibly damaging 0.81
R6814:Tgoln1 UTSW 6 72,592,538 (GRCm39) missense possibly damaging 0.90
R6872:Tgoln1 UTSW 6 72,592,538 (GRCm39) missense possibly damaging 0.90
R7178:Tgoln1 UTSW 6 72,593,028 (GRCm39) missense probably benign 0.01
R7339:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7342:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7347:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7348:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7366:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7368:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7491:Tgoln1 UTSW 6 72,593,403 (GRCm39) missense unknown
R8277:Tgoln1 UTSW 6 72,593,838 (GRCm39) start gained probably benign
R8979:Tgoln1 UTSW 6 72,593,262 (GRCm39) missense probably benign 0.00
R9566:Tgoln1 UTSW 6 72,592,911 (GRCm39) missense probably benign 0.00
RF003:Tgoln1 UTSW 6 72,593,335 (GRCm39) nonsense probably null
RF023:Tgoln1 UTSW 6 72,593,063 (GRCm39) small insertion probably benign
RF028:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF030:Tgoln1 UTSW 6 72,593,046 (GRCm39) small insertion probably benign
RF030:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF032:Tgoln1 UTSW 6 72,593,057 (GRCm39) small insertion probably benign
RF032:Tgoln1 UTSW 6 72,593,046 (GRCm39) small insertion probably benign
RF037:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF040:Tgoln1 UTSW 6 72,593,057 (GRCm39) small insertion probably benign
RF042:Tgoln1 UTSW 6 72,593,057 (GRCm39) small insertion probably benign
RF043:Tgoln1 UTSW 6 72,593,046 (GRCm39) small insertion probably benign
RF043:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF057:Tgoln1 UTSW 6 72,593,052 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTCCATGAACAAAGAACTTAGGGTC -3'
(R):5'- ACTGAATCTGGGGAAACACTGG -3'

Sequencing Primer
(F):5'- GAACTTAGGGTCCTGGAAATCCC -3'
(R):5'- GCAGGGGACTCTGACTTCTC -3'
Posted On 2015-09-24