Incidental Mutation 'R4559:Tgoln1'
ID342982
Institutional Source Beutler Lab
Gene Symbol Tgoln1
Ensembl Gene ENSMUSG00000056429
Gene Nametrans-golgi network protein
SynonymsTtgn1, D6Ertd384e, TGN38, TGN38A
MMRRC Submission 041785-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R4559 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location72608432-72617000 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72615681 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 272 (E272G)
Ref Sequence ENSEMBL: ENSMUSP00000068487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070524]
Predicted Effect probably damaging
Transcript: ENSMUST00000070524
AA Change: E272G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068487
Gene: ENSMUSG00000056429
AA Change: E272G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 58 74 N/A INTRINSIC
low complexity region 238 260 N/A INTRINSIC
transmembrane domain 300 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172588
Meta Mutation Damage Score 0.2809 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,513,091 noncoding transcript Het
1700066M21Rik T C 1: 57,382,924 F153S possibly damaging Het
Acss1 A G 2: 150,638,485 V222A probably benign Het
Atad2b A G 12: 4,943,223 I247M probably benign Het
Atxn10 A G 15: 85,438,120 I398V possibly damaging Het
Cep192 T A 18: 67,871,513 C2312S probably damaging Het
Cidea C T 18: 67,360,228 Q106* probably null Het
Cnga4 A G 7: 105,405,685 T159A probably damaging Het
Cyp2j12 G T 4: 96,112,957 S304R probably damaging Het
Dsg4 T A 18: 20,470,921 V815E probably damaging Het
Fam122b G A X: 53,260,677 probably benign Het
Fam189a2 G A 19: 24,030,549 S130L probably damaging Het
Farp1 T C 14: 121,272,801 M737T probably damaging Het
Fbn1 T A 2: 125,351,714 D1395V possibly damaging Het
Fbn2 C T 18: 58,076,074 M1076I probably benign Het
Fitm2 T A 2: 163,472,673 probably benign Het
Fras1 A G 5: 96,781,289 R3851G probably damaging Het
Frem2 C T 3: 53,654,321 V922I probably benign Het
Gm10719 A T 9: 3,018,945 T200S probably benign Het
Grin3a T C 4: 49,844,555 D176G probably damaging Het
Hdac5 T C 11: 102,199,102 probably benign Het
Ift140 C A 17: 25,090,767 H1090Q probably damaging Het
Il20ra A G 10: 19,749,284 T104A probably damaging Het
Il22ra2 A G 10: 19,626,712 D93G possibly damaging Het
Ing1 A G 8: 11,562,090 K176R probably benign Het
Jph1 A T 1: 17,004,511 C428S probably benign Het
Kif13b G T 14: 64,806,132 G1794W probably damaging Het
Map10 A G 8: 125,671,814 T649A probably benign Het
Med12l T C 3: 59,007,102 probably null Het
Nat8f1 A G 6: 85,910,585 I131T probably benign Het
Oas1d C A 5: 120,916,895 Q177K probably benign Het
Olfr1247 C A 2: 89,609,699 M134I probably damaging Het
Olfr635 G A 7: 103,979,560 D123N probably damaging Het
P2ry2 A G 7: 100,998,156 V314A possibly damaging Het
Pfkl G T 10: 77,988,883 R691S probably benign Het
Plb1 T A 5: 32,332,831 I1005N probably damaging Het
Prkacb A G 3: 146,745,392 probably benign Het
Ptprm A T 17: 66,683,408 Y1412N possibly damaging Het
Rab22a A G 2: 173,661,433 D13G probably damaging Het
Rab29 G A 1: 131,872,567 W201* probably null Het
Rasa3 T C 8: 13,598,259 E135G probably damaging Het
Rassf10 A G 7: 112,955,131 E313G probably benign Het
Sf1 GGCAGCAGCAGCAGCAGCAGC GGCAGCAGCAGCAGCAGC 19: 6,374,815 probably benign Het
Sipa1l3 A T 7: 29,332,253 L468Q probably damaging Het
Slc17a1 A T 13: 23,878,712 K254* probably null Het
Slc6a12 G A 6: 121,363,861 probably null Het
Slfn8 A G 11: 83,004,744 L412P probably damaging Het
St5 A G 7: 109,525,578 F665L probably damaging Het
Taf4b T C 18: 14,813,526 S469P probably damaging Het
Tlr12 C A 4: 128,615,770 G896W probably damaging Het
Tnfrsf1a A G 6: 125,360,766 I229V probably benign Het
Ttn G A 2: 76,919,546 H3720Y probably benign Het
Other mutations in Tgoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Tgoln1 APN 6 72616090 missense probably benign 0.00
IGL00795:Tgoln1 APN 6 72616252 missense probably benign 0.01
IGL03002:Tgoln1 APN 6 72616072 missense possibly damaging 0.83
IGL03136:Tgoln1 APN 6 72614113 missense probably damaging 1.00
FR4340:Tgoln1 UTSW 6 72616351 small insertion probably benign
R0684:Tgoln1 UTSW 6 72615991 missense probably benign 0.00
R1656:Tgoln1 UTSW 6 72614085 missense probably damaging 0.99
R1920:Tgoln1 UTSW 6 72616101 missense probably benign 0.01
R2057:Tgoln1 UTSW 6 72615670 missense probably benign 0.35
R4097:Tgoln1 UTSW 6 72615801 missense probably damaging 0.98
R4995:Tgoln1 UTSW 6 72616140 missense possibly damaging 0.92
R5566:Tgoln1 UTSW 6 72616035 missense possibly damaging 0.92
R6224:Tgoln1 UTSW 6 72616001 missense possibly damaging 0.81
R6814:Tgoln1 UTSW 6 72615555 missense possibly damaging 0.90
R6872:Tgoln1 UTSW 6 72615555 missense possibly damaging 0.90
R7178:Tgoln1 UTSW 6 72616045 missense probably benign 0.01
R7339:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7342:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7347:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7348:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7366:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7368:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7491:Tgoln1 UTSW 6 72616420 missense unknown
R8277:Tgoln1 UTSW 6 72616855 start gained probably benign
RF003:Tgoln1 UTSW 6 72616352 nonsense probably null
RF023:Tgoln1 UTSW 6 72616080 small insertion probably benign
RF028:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF030:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF030:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF032:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF032:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF037:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF040:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF042:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF043:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF043:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF057:Tgoln1 UTSW 6 72616069 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GTCCATGAACAAAGAACTTAGGGTC -3'
(R):5'- ACTGAATCTGGGGAAACACTGG -3'

Sequencing Primer
(F):5'- GAACTTAGGGTCCTGGAAATCCC -3'
(R):5'- GCAGGGGACTCTGACTTCTC -3'
Posted On2015-09-24