Incidental Mutation 'R7368:Tgoln1'
ID 571922
Institutional Source Beutler Lab
Gene Symbol Tgoln1
Ensembl Gene ENSMUSG00000056429
Gene Name trans-golgi network protein
Synonyms Ttgn1, D6Ertd384e, TGN38, TGN38A
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R7368 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 72608432-72617000 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 72616278 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Arginine at position 73 (T73R)
Ref Sequence ENSEMBL: ENSMUSP00000068487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070524]
AlphaFold Q62313
Predicted Effect probably benign
Transcript: ENSMUST00000070524
AA Change: T73R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000068487
Gene: ENSMUSG00000056429
AA Change: T73R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 58 74 N/A INTRINSIC
low complexity region 238 260 N/A INTRINSIC
transmembrane domain 300 319 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,612,865 F153I possibly damaging Het
Adcy1 G A 11: 7,144,765 V564I probably damaging Het
Apol9b T C 15: 77,735,934 I310T possibly damaging Het
Arhgef28 C A 13: 97,996,862 V366F probably benign Het
B020004C17Rik C T 14: 57,017,316 T199I possibly damaging Het
Carmil2 C T 8: 105,690,835 T575I possibly damaging Het
Catsper1 A T 19: 5,336,663 Q308L unknown Het
Cpa2 T A 6: 30,551,990 S239T probably damaging Het
Ddit3 G A 10: 127,295,907 G108D probably damaging Het
Dnah3 T C 7: 120,029,016 I1473V probably benign Het
Dscam A G 16: 96,643,931 V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 105,888,405 probably benign Het
Ednrb T A 14: 103,820,017 I370F probably benign Het
Ehd3 A G 17: 73,827,462 E272G possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fam49b A T 15: 63,938,658 probably null Het
Fkbp11 T C 15: 98,724,426 K189E unknown Het
Frem1 T A 4: 82,966,144 E1190D probably benign Het
Gabrg2 A C 11: 41,976,563 Y76* probably null Het
Gm11437 T A 11: 84,167,472 probably benign Het
Gm8947 C A 1: 151,193,096 Q227K probably benign Het
Gm9195 A G 14: 72,480,056 F279S probably damaging Het
Gpbp1l1 T C 4: 116,573,458 I42T probably benign Het
Hdac5 A T 11: 102,197,381 V939E probably null Het
Hivep3 CGG CG 4: 120,097,911 1141 probably null Het
Kitl A T 10: 100,016,081 I21F probably benign Het
Krt1 T C 15: 101,846,872 D484G probably damaging Het
Larp1 C A 11: 58,048,078 P527T probably damaging Het
Lrp5 A G 19: 3,620,085 V673A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mmp27 G A 9: 7,577,317 V228M probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 G T 11: 60,490,915 probably null Het
Myt1 A G 2: 181,782,591 K26E possibly damaging Het
Nek1 T A 8: 61,089,707 I777N probably benign Het
Nlrc5 C T 8: 94,476,393 R374* probably null Het
Nol8 T C 13: 49,661,219 S268P probably benign Het
Nynrin T A 14: 55,870,511 L1025Q probably damaging Het
Olfr1099 A G 2: 86,959,258 S67P probably damaging Het
Osbpl3 A T 6: 50,348,098 L140H probably damaging Het
Pcnt T C 10: 76,400,001 N1382S probably benign Het
Pef1 T A 4: 130,127,385 L244* probably null Het
Phf11a T C 14: 59,280,725 E191G probably benign Het
Polr3a A T 14: 24,467,076 D702E probably damaging Het
Ptch1 C T 13: 63,511,984 G1285D probably benign Het
Ptpn3 T C 4: 57,221,993 D566G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Scgb1b12 T C 7: 32,334,567 I84T probably damaging Het
Sh2b1 A T 7: 126,468,513 D618E possibly damaging Het
Slc35f5 T A 1: 125,584,519 V352E probably damaging Het
Sppl2c A G 11: 104,187,604 E410G probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stra6 G A 9: 58,151,260 R468Q probably benign Het
Taf3 T C 2: 9,916,377 H924R unknown Het
Tbx18 C A 9: 87,730,697 V50L probably benign Het
Unc45b C T 11: 82,942,495 T845I probably benign Het
Usp15 T C 10: 123,196,893 D8G possibly damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Vps13c C A 9: 67,914,073 D1288E probably benign Het
Zfp458 T A 13: 67,257,236 M380L probably benign Het
Zfp638 A G 6: 83,929,455 N201D possibly damaging Het
Other mutations in Tgoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Tgoln1 APN 6 72616090 missense probably benign 0.00
IGL00795:Tgoln1 APN 6 72616252 missense probably benign 0.01
IGL03002:Tgoln1 APN 6 72616072 missense possibly damaging 0.83
IGL03136:Tgoln1 APN 6 72614113 missense probably damaging 1.00
FR4340:Tgoln1 UTSW 6 72616351 small insertion probably benign
R0684:Tgoln1 UTSW 6 72615991 missense probably benign 0.00
R1656:Tgoln1 UTSW 6 72614085 missense probably damaging 0.99
R1920:Tgoln1 UTSW 6 72616101 missense probably benign 0.01
R2057:Tgoln1 UTSW 6 72615670 missense probably benign 0.35
R4097:Tgoln1 UTSW 6 72615801 missense probably damaging 0.98
R4559:Tgoln1 UTSW 6 72615681 missense probably damaging 0.98
R4995:Tgoln1 UTSW 6 72616140 missense possibly damaging 0.92
R5566:Tgoln1 UTSW 6 72616035 missense possibly damaging 0.92
R6224:Tgoln1 UTSW 6 72616001 missense possibly damaging 0.81
R6814:Tgoln1 UTSW 6 72615555 missense possibly damaging 0.90
R6872:Tgoln1 UTSW 6 72615555 missense possibly damaging 0.90
R7178:Tgoln1 UTSW 6 72616045 missense probably benign 0.01
R7339:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7342:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7347:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7348:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7366:Tgoln1 UTSW 6 72616278 missense probably benign 0.03
R7491:Tgoln1 UTSW 6 72616420 missense unknown
R8277:Tgoln1 UTSW 6 72616855 start gained probably benign
R8979:Tgoln1 UTSW 6 72616279 missense probably benign 0.00
R9566:Tgoln1 UTSW 6 72615928 missense probably benign 0.00
RF003:Tgoln1 UTSW 6 72616352 nonsense probably null
RF023:Tgoln1 UTSW 6 72616080 small insertion probably benign
RF028:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF030:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF030:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF032:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF032:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF037:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF040:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF042:Tgoln1 UTSW 6 72616074 small insertion probably benign
RF043:Tgoln1 UTSW 6 72616036 small insertion probably benign
RF043:Tgoln1 UTSW 6 72616063 small insertion probably benign
RF057:Tgoln1 UTSW 6 72616069 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTTGCCAGAATCACCTCCTG -3'
(R):5'- AGCTCTGCCGTCCGTTTATAAG -3'

Sequencing Primer
(F):5'- TGGGCTTGCCAGAATTACC -3'
(R):5'- CTGCCGTCCGTTTATAAGAGAGAC -3'
Posted On 2019-09-13