Incidental Mutation 'R4559:Fam189a2'
ID386355
Institutional Source Beutler Lab
Gene Symbol Fam189a2
Ensembl Gene ENSMUSG00000071604
Gene Namefamily with sequence similarity 189, member A2
SynonymsLOC381217
MMRRC Submission 041785-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4559 (G1)
Quality Score148
Status Validated
Chromosome19
Chromosomal Location23972751-24031019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24030549 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 130 (S130L)
Ref Sequence ENSEMBL: ENSMUSP00000093878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096164]
Predicted Effect probably damaging
Transcript: ENSMUST00000096164
AA Change: S130L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093878
Gene: ENSMUSG00000071604
AA Change: S130L

DomainStartEndE-ValueType
Pfam:CD20 91 254 9.5e-33 PFAM
low complexity region 282 294 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
Meta Mutation Damage Score 0.1823 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017G19Rik A G 3: 40,513,091 noncoding transcript Het
1700066M21Rik T C 1: 57,382,924 F153S possibly damaging Het
Acss1 A G 2: 150,638,485 V222A probably benign Het
Atad2b A G 12: 4,943,223 I247M probably benign Het
Atxn10 A G 15: 85,438,120 I398V possibly damaging Het
Cep192 T A 18: 67,871,513 C2312S probably damaging Het
Cidea C T 18: 67,360,228 Q106* probably null Het
Cnga4 A G 7: 105,405,685 T159A probably damaging Het
Cyp2j12 G T 4: 96,112,957 S304R probably damaging Het
Dsg4 T A 18: 20,470,921 V815E probably damaging Het
Fam122b G A X: 53,260,677 probably benign Het
Farp1 T C 14: 121,272,801 M737T probably damaging Het
Fbn1 T A 2: 125,351,714 D1395V possibly damaging Het
Fbn2 C T 18: 58,076,074 M1076I probably benign Het
Fitm2 T A 2: 163,472,673 probably benign Het
Fras1 A G 5: 96,781,289 R3851G probably damaging Het
Frem2 C T 3: 53,654,321 V922I probably benign Het
Gm10719 A T 9: 3,018,945 T200S probably benign Het
Grin3a T C 4: 49,844,555 D176G probably damaging Het
Hdac5 T C 11: 102,199,102 probably benign Het
Ift140 C A 17: 25,090,767 H1090Q probably damaging Het
Il20ra A G 10: 19,749,284 T104A probably damaging Het
Il22ra2 A G 10: 19,626,712 D93G possibly damaging Het
Ing1 A G 8: 11,562,090 K176R probably benign Het
Jph1 A T 1: 17,004,511 C428S probably benign Het
Kif13b G T 14: 64,806,132 G1794W probably damaging Het
Map10 A G 8: 125,671,814 T649A probably benign Het
Med12l T C 3: 59,007,102 probably null Het
Nat8f1 A G 6: 85,910,585 I131T probably benign Het
Oas1d C A 5: 120,916,895 Q177K probably benign Het
Olfr1247 C A 2: 89,609,699 M134I probably damaging Het
Olfr635 G A 7: 103,979,560 D123N probably damaging Het
P2ry2 A G 7: 100,998,156 V314A possibly damaging Het
Pfkl G T 10: 77,988,883 R691S probably benign Het
Plb1 T A 5: 32,332,831 I1005N probably damaging Het
Prkacb A G 3: 146,745,392 probably benign Het
Ptprm A T 17: 66,683,408 Y1412N possibly damaging Het
Rab22a A G 2: 173,661,433 D13G probably damaging Het
Rab29 G A 1: 131,872,567 W201* probably null Het
Rasa3 T C 8: 13,598,259 E135G probably damaging Het
Rassf10 A G 7: 112,955,131 E313G probably benign Het
Sf1 GGCAGCAGCAGCAGCAGCAGC GGCAGCAGCAGCAGCAGC 19: 6,374,815 probably benign Het
Sipa1l3 A T 7: 29,332,253 L468Q probably damaging Het
Slc17a1 A T 13: 23,878,712 K254* probably null Het
Slc6a12 G A 6: 121,363,861 probably null Het
Slfn8 A G 11: 83,004,744 L412P probably damaging Het
St5 A G 7: 109,525,578 F665L probably damaging Het
Taf4b T C 18: 14,813,526 S469P probably damaging Het
Tgoln1 T C 6: 72,615,681 E272G probably damaging Het
Tlr12 C A 4: 128,615,770 G896W probably damaging Het
Tnfrsf1a A G 6: 125,360,766 I229V probably benign Het
Ttn G A 2: 76,919,546 H3720Y probably benign Het
Other mutations in Fam189a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Fam189a2 APN 19 23984722 missense probably damaging 1.00
IGL03162:Fam189a2 APN 19 23988460 missense probably damaging 1.00
R0285:Fam189a2 UTSW 19 23979385 splice site probably benign
R0613:Fam189a2 UTSW 19 23986489 missense probably damaging 1.00
R1078:Fam189a2 UTSW 19 23973575 missense probably benign 0.01
R1122:Fam189a2 UTSW 19 23975392 missense probably damaging 1.00
R1228:Fam189a2 UTSW 19 23979465 missense probably benign 0.00
R1445:Fam189a2 UTSW 19 24021634 missense probably damaging 1.00
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1547:Fam189a2 UTSW 19 23979701 missense probably damaging 1.00
R1657:Fam189a2 UTSW 19 23975635 missense probably damaging 1.00
R1710:Fam189a2 UTSW 19 23979695 missense probably damaging 1.00
R3701:Fam189a2 UTSW 19 23979467 missense probably benign 0.00
R4163:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4163:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4418:Fam189a2 UTSW 19 23979435 missense probably benign
R4558:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4866:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4879:Fam189a2 UTSW 19 23975655 critical splice acceptor site probably null
R4900:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4934:Fam189a2 UTSW 19 23973425 makesense probably null
R5530:Fam189a2 UTSW 19 23975594 missense probably benign 0.01
R5942:Fam189a2 UTSW 19 23986470 missense probably damaging 1.00
R6041:Fam189a2 UTSW 19 23984829 missense probably benign 0.41
R6207:Fam189a2 UTSW 19 23973438 missense probably damaging 1.00
R6572:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R6573:Fam189a2 UTSW 19 23988502 missense probably damaging 1.00
R6711:Fam189a2 UTSW 19 23978099 missense probably benign 0.02
R6952:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R7621:Fam189a2 UTSW 19 23994804 missense possibly damaging 0.68
X0018:Fam189a2 UTSW 19 23975646 frame shift probably null
X0020:Fam189a2 UTSW 19 23975646 frame shift probably null
X0027:Fam189a2 UTSW 19 23975646 frame shift probably null
X0065:Fam189a2 UTSW 19 23975646 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACTTGACTGTCTCCCGACAC -3'
(R):5'- TGGACACTTTTCCCGGTGAC -3'

Sequencing Primer
(F):5'- TGACTGTCTCCCGACACTAACC -3'
(R):5'- TGCTCTGCAGCCTCCAG -3'
Posted On2016-05-19