Incidental Mutation 'R4565:Rbmxl1'
ID343288
Institutional Source Beutler Lab
Gene Symbol Rbmxl1
Ensembl Gene ENSMUSG00000037070
Gene NameRNA binding motif protein, X-linked like-1
SynonymshnRNP G, Rbmxrt, Hnrpg
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4565 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location78505269-78508898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78506010 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 235 (P235S)
Ref Sequence ENSEMBL: ENSMUSP00000147384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034111] [ENSMUST00000049245] [ENSMUST00000209490] [ENSMUST00000209992] [ENSMUST00000210515] [ENSMUST00000210630] [ENSMUST00000211286] [ENSMUST00000211719]
Predicted Effect probably benign
Transcript: ENSMUST00000034111
SMART Domains Protein: ENSMUSP00000034111
Gene: ENSMUSG00000031684

DomainStartEndE-ValueType
Pfam:SBF_like 10 324 1.9e-82 PFAM
Pfam:SBF 44 224 2.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049245
AA Change: P235S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048153
Gene: ENSMUSG00000037070
AA Change: P235S

DomainStartEndE-ValueType
RRM 9 82 2.31e-28 SMART
low complexity region 91 124 N/A INTRINSIC
low complexity region 145 168 N/A INTRINSIC
Pfam:RBM1CTR 170 214 5.5e-26 PFAM
low complexity region 215 231 N/A INTRINSIC
low complexity region 236 271 N/A INTRINSIC
low complexity region 300 338 N/A INTRINSIC
low complexity region 352 387 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209490
Predicted Effect probably benign
Transcript: ENSMUST00000209992
Predicted Effect probably benign
Transcript: ENSMUST00000210515
Predicted Effect probably benign
Transcript: ENSMUST00000210630
Predicted Effect probably benign
Transcript: ENSMUST00000211286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211332
Predicted Effect probably benign
Transcript: ENSMUST00000211719
AA Change: P235S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,227,947 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg3l1 A T 8: 123,501,869 K725* probably null Het
Alkbh1 T C 12: 87,431,466 D225G probably damaging Het
Anxa2 A T 9: 69,489,737 K241M probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dcdc2b T C 4: 129,610,985 T118A probably benign Het
Dhx35 C A 2: 158,849,535 A646E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Haspin G A 11: 73,137,619 L215F probably benign Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Limk2 A G 11: 3,348,634 I261T probably damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr19 C A 16: 16,673,693 G96V probably damaging Het
Olfr447 A T 6: 42,911,538 Q5L probably benign Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Zfp618 T C 4: 63,121,351 C396R probably damaging Het
Other mutations in Rbmxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Rbmxl1 APN 8 78505830 nonsense probably null
R1735:Rbmxl1 UTSW 8 78506082 missense probably damaging 1.00
R5781:Rbmxl1 UTSW 8 78505641 unclassified probably benign
R6093:Rbmxl1 UTSW 8 78505943 missense probably damaging 1.00
R7028:Rbmxl1 UTSW 8 78506657 missense probably damaging 1.00
R7737:Rbmxl1 UTSW 8 78505623 missense unknown
Predicted Primers PCR Primer
(F):5'- CGTGAGCTGCTGTAATCATCATAG -3'
(R):5'- AAGAACACCAGTGTCCCGTG -3'

Sequencing Primer
(F):5'- GCTGCTGTAATCATCATAGCGACTG -3'
(R):5'- TGTCCCGTGGAAGAGATAGCTAC -3'
Posted On2015-09-24