Incidental Mutation 'R4565:Anxa2'
ID343292
Institutional Source Beutler Lab
Gene Symbol Anxa2
Ensembl Gene ENSMUSG00000032231
Gene Nameannexin A2
Synonymslipocortin II, annexin II, Cal1h, 36-kDa calelectrin
MMRRC Submission 041790-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4565 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location69453620-69491795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69489737 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 241 (K241M)
Ref Sequence ENSEMBL: ENSMUSP00000117855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034756] [ENSMUST00000123470] [ENSMUST00000136282]
Predicted Effect probably damaging
Transcript: ENSMUST00000034756
AA Change: K308M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034756
Gene: ENSMUSG00000032231
AA Change: K308M

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
ANX 207 259 8.2e-11 SMART
ANX 282 334 1.6e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123470
SMART Domains Protein: ENSMUSP00000122175
Gene: ENSMUSG00000032231

DomainStartEndE-ValueType
ANX 50 102 5.79e-20 SMART
ANX 122 174 1.5e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136282
AA Change: K241M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117855
Gene: ENSMUSG00000032231
AA Change: K241M

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
ANX 55 107 1.5e-27 SMART
ANX 140 192 8.2e-11 SMART
ANX 215 267 1.6e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154591
Meta Mutation Damage Score 0.3265 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. This protein functions as an autocrine factor which heightens osteoclast formation and bone resorption. This gene has three pseudogenes located on chromosomes 4, 9 and 10, respectively. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are viable and fertile but suffer from growth deficits, impaired angiogenesis, and increased susceptibility to thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik T C 5: 99,227,947 probably benign Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Afg3l1 A T 8: 123,501,869 K725* probably null Het
Alkbh1 T C 12: 87,431,466 D225G probably damaging Het
Bptf G A 11: 107,073,010 T1786M probably damaging Het
Cnst A G 1: 179,604,549 E208G probably damaging Het
Dcdc2b T C 4: 129,610,985 T118A probably benign Het
Dhx35 C A 2: 158,849,535 A646E probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnhd1 T A 7: 105,651,956 D173E possibly damaging Het
Dpy19l1 A T 9: 24,432,388 L487Q probably null Het
Gtse1 T G 15: 85,875,184 V631G probably damaging Het
Haspin G A 11: 73,137,619 L215F probably benign Het
Herc2 T C 7: 56,153,838 V2207A possibly damaging Het
Jph1 A G 1: 17,004,202 Y531H possibly damaging Het
Limk2 A G 11: 3,348,634 I261T probably damaging Het
Oas3 A G 5: 120,771,039 F281L probably damaging Het
Olfr19 C A 16: 16,673,693 G96V probably damaging Het
Olfr447 A T 6: 42,911,538 Q5L probably benign Het
Pcdhb17 A G 18: 37,486,470 T438A probably benign Het
Pfdn5 T C 15: 102,326,785 probably benign Het
Rab11fip3 A G 17: 26,068,706 C158R possibly damaging Het
Rbmxl1 G A 8: 78,506,010 P235S probably benign Het
Slc9b1 G T 3: 135,382,717 V280F probably damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Trpm3 T C 19: 22,987,869 I1576T probably benign Het
Trpm6 T A 19: 18,825,872 V893D probably damaging Het
Ttc13 A T 8: 124,682,087 N583K probably damaging Het
Zfp618 T C 4: 63,121,351 C396R probably damaging Het
Other mutations in Anxa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Anxa2 APN 9 69483019 nonsense probably null
IGL02550:Anxa2 APN 9 69467306 missense probably benign 0.00
FR4342:Anxa2 UTSW 9 69480205 small insertion probably benign
FR4342:Anxa2 UTSW 9 69480210 small insertion probably benign
FR4548:Anxa2 UTSW 9 69480203 small insertion probably benign
FR4589:Anxa2 UTSW 9 69480210 small insertion probably benign
R1480:Anxa2 UTSW 9 69489754 frame shift probably null
R1482:Anxa2 UTSW 9 69489754 frame shift probably null
R1519:Anxa2 UTSW 9 69485241 missense probably damaging 1.00
R1609:Anxa2 UTSW 9 69489754 frame shift probably null
R1610:Anxa2 UTSW 9 69489754 frame shift probably null
R1624:Anxa2 UTSW 9 69479708 missense probably benign 0.10
R1672:Anxa2 UTSW 9 69489754 frame shift probably null
R1696:Anxa2 UTSW 9 69489754 frame shift probably null
R1760:Anxa2 UTSW 9 69489767 missense probably benign 0.00
R1775:Anxa2 UTSW 9 69488081 missense possibly damaging 0.93
R1828:Anxa2 UTSW 9 69482978 missense probably damaging 1.00
R1884:Anxa2 UTSW 9 69489754 frame shift probably null
R1991:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2020:Anxa2 UTSW 9 69483817 missense probably damaging 0.99
R2029:Anxa2 UTSW 9 69464480 missense possibly damaging 0.71
R2103:Anxa2 UTSW 9 69483816 missense probably damaging 1.00
R2129:Anxa2 UTSW 9 69476128 missense possibly damaging 0.48
R2146:Anxa2 UTSW 9 69489754 frame shift probably null
R2148:Anxa2 UTSW 9 69489754 frame shift probably null
R2149:Anxa2 UTSW 9 69489754 frame shift probably null
R2150:Anxa2 UTSW 9 69489754 frame shift probably null
R2437:Anxa2 UTSW 9 69489764 missense probably damaging 1.00
R3848:Anxa2 UTSW 9 69467342 missense probably damaging 1.00
R4036:Anxa2 UTSW 9 69488070 missense probably damaging 0.99
R4731:Anxa2 UTSW 9 69486530 missense probably benign 0.41
R5172:Anxa2 UTSW 9 69485251 missense probably damaging 0.99
R5181:Anxa2 UTSW 9 69476065 missense probably benign 0.00
R6427:Anxa2 UTSW 9 69476149 critical splice donor site probably null
R6759:Anxa2 UTSW 9 69483821 missense probably damaging 1.00
R7725:Anxa2 UTSW 9 69480128 missense unknown
R7734:Anxa2 UTSW 9 69491482 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CACATGAGTGCAGGCATTAAAC -3'
(R):5'- ACAGGAAGGTCACCACTCTG -3'

Sequencing Primer
(F):5'- CAGCTTTAGGGGATCTGACACTC -3'
(R):5'- GAAGGTCACCACTCTGCCATTG -3'
Posted On2015-09-24