Mutagenetix > Incidental Mutation

Incidental Mutation 'R4607:Nostrin'

346057

Institutional Source

Beutler Lab

Gene Symbol

Nostrin

Ensembl Gene

ENSMUSG00000034738

Gene Name

nitric oxide synthase trafficker

Synonyms

mDaIP2

MMRRC Submission

041818-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.235) question?

Stock #

R4607 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69135800-69189330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 69183899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 400 (V400M)

Ref Sequence

ENSEMBL: ENSMUSP00000036923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041865]

AlphaFold

Q6WKZ7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041865
AA Change: V400M

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000036923
Gene: ENSMUSG00000034738
AA Change: V400M

Domain	Start	End	E-Value	Type
Pfam:FCH	13	88	4.9e-12	PFAM
low complexity region	135	146	N/A	INTRINSIC
coiled coil region	160	190	N/A	INTRINSIC
coiled coil region	305	334	N/A	INTRINSIC
low complexity region	419	439	N/A	INTRINSIC
SH3	441	496	8.89e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141276

Meta Mutation Damage Score

0.1366

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (65/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide (NO) is a potent mediator in biologic processes such as neurotransmission, inflammatory response, and vascular homeostasis. NOSTRIN binds the enzyme responsible for NO production, endothelial NO synthase (ENOS; MIM 163729), and triggers the translocation of ENOS from the plasma membrane to vesicle-like subcellular structures, thereby attenuating ENOS-dependent NO production.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired retinal vascular angiogenesis, endothelial cell proliferation, endothelial cell migration and induced neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AA792892	G	T	5: 94,383,528	R90S	probably benign	Het
Acss3	T	A	10: 106,967,029	I452F	possibly damaging	Het
Adgra3	A	C	5: 49,970,739	V800G	probably damaging	Het
Aldh1a1	A	T	19: 20,621,687	Y154F	probably benign	Het
Bbs10	T	G	10: 111,300,820	I598S	probably damaging	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Ccnl1	C	T	3: 65,946,710		probably benign	Het
Chrna9	A	G	5: 65,976,735	I310V	possibly damaging	Het
Cpeb3	A	G	19: 37,174,839	S46P	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dlgap5	A	G	14: 47,413,018	I151T	possibly damaging	Het
Dsg4	C	T	18: 20,471,245	T923M	probably damaging	Het
Eif4g3	G	T	4: 138,126,458	R618L	probably benign	Het
Erlin1	C	T	19: 44,063,035	V76M	probably damaging	Het
Fam161a	G	A	11: 23,020,710	S296N	probably benign	Het
Fam187b	T	A	7: 30,977,745	N226K	probably benign	Het
Fes	G	A	7: 80,387,211	R42W	probably damaging	Het
Fmnl2	T	A	2: 53,103,716	N374K	possibly damaging	Het
Fpgt	G	A	3: 155,086,696	Q565*	probably null	Het
Gm26657	C	A	4: 56,741,114	H100N	probably benign	Het
Gm906	G	A	13: 50,245,506	T928I	possibly damaging	Het
Gna14	A	G	19: 16,533,711		probably null	Het
Gsg1l	T	A	7: 125,958,549	I136F	probably damaging	Het
Hhip	C	T	8: 79,997,563	R350Q	probably damaging	Het
Ints10	G	A	8: 68,810,619	R394Q	probably damaging	Het
Ipo11	A	G	13: 106,900,811	S175P	probably damaging	Het
Klk13	C	A	7: 43,713,860	C10*	probably null	Het
Leng8	T	A	7: 4,144,797	I607N	probably damaging	Het
Map3k2	T	C	18: 32,199,977	L68P	probably damaging	Het
Memo1	G	A	17: 74,258,461	Q36*	probably null	Het
Mink1	A	G	11: 70,606,067	E417G	possibly damaging	Het
Myrf	G	T	19: 10,229,067	D29E	probably damaging	Het
Nelfcd	T	A	2: 174,423,162	D215E	probably benign	Het
Nrip1	T	C	16: 76,293,032	T546A	probably benign	Het
Olfr1219	G	T	2: 89,074,312	P260T	probably benign	Het
Olfr303	A	T	7: 86,394,510		probably null	Het
Olfr365	T	A	2: 37,202,082	Y280*	probably null	Het
Olfr538	A	G	7: 140,574,641	M163V	probably benign	Het
Olfr753-ps1	A	T	17: 37,170,282	V20E	probably damaging	Het
Olfr951	T	C	9: 39,394,735	*312Q	probably null	Het
P2ry6	A	G	7: 100,938,304	Y283H	probably damaging	Het
Pcdh9	T	A	14: 93,015,573	N1218I	probably benign	Het
Pcdhga6	A	G	18: 37,708,618	N464D	probably damaging	Het
Rdx	T	A	9: 52,068,837	S243R	probably damaging	Het
Rxfp1	T	C	3: 79,686,889	N66S	probably damaging	Het
Slit1	C	A	19: 41,616,793	R873L	probably benign	Het
Strc	T	A	2: 121,372,945	I1130F	probably benign	Het
Tlk2	T	A	11: 105,255,018	L350Q	probably damaging	Het
Tmem74	G	T	15: 43,867,158	T163K	probably damaging	Het
Trav15-1-dv6-1	T	A	14: 53,560,054	H53Q	probably benign	Het
Trbv24	T	C	6: 41,218,401		probably benign	Het
Uba2	T	C	7: 34,154,596	D307G	probably damaging	Het
Uty	C	T	Y: 1,131,134	R924Q	probably damaging	Het
Wdr7	C	T	18: 63,777,580	T681I	probably benign	Het
Zbtb42	C	T	12: 112,680,542	R384W	probably damaging	Het
Zfand4	T	A	6: 116,328,234	C207*	probably null	Het
Zfp512b	C	A	2: 181,588,774	R441L	probably damaging	Het

Other mutations in Nostrin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Nostrin	APN	2	69185554	splice site	probably benign
IGL00502:Nostrin	APN	2	69183992	missense	probably benign
IGL00767:Nostrin	APN	2	69175775	missense	probably benign	0.00
IGL00846:Nostrin	APN	2	69185555	splice site	probably benign
IGL00912:Nostrin	APN	2	69182819	splice site	probably benign
IGL02123:Nostrin	APN	2	69156109	splice site	probably benign
IGL02213:Nostrin	APN	2	69183918	missense	probably benign	0.25
R0295:Nostrin	UTSW	2	69179416	missense	probably benign	0.19
R0543:Nostrin	UTSW	2	69189131	makesense	probably null
R1384:Nostrin	UTSW	2	69189062	missense	probably benign	0.05
R1501:Nostrin	UTSW	2	69158785	missense	probably damaging	1.00
R1632:Nostrin	UTSW	2	69175734	missense	probably benign	0.21
R2012:Nostrin	UTSW	2	69144767	splice site	probably null
R2140:Nostrin	UTSW	2	69166003	missense	probably damaging	0.98
R2159:Nostrin	UTSW	2	69180922	splice site	probably null
R2329:Nostrin	UTSW	2	69161094	missense	probably damaging	1.00
R2890:Nostrin	UTSW	2	69180905	missense	probably benign
R4469:Nostrin	UTSW	2	69175717	missense	probably damaging	0.99
R4608:Nostrin	UTSW	2	69183899	missense	possibly damaging	0.89
R4684:Nostrin	UTSW	2	69183924	missense	probably benign	0.00
R4719:Nostrin	UTSW	2	69144812	nonsense	probably null
R4846:Nostrin	UTSW	2	69175579	missense	probably damaging	1.00
R4911:Nostrin	UTSW	2	69161142	missense	possibly damaging	0.87
R4987:Nostrin	UTSW	2	69156431	missense	probably benign
R5054:Nostrin	UTSW	2	69175713	missense	possibly damaging	0.82
R5177:Nostrin	UTSW	2	69175754	missense	possibly damaging	0.83
R6561:Nostrin	UTSW	2	69180857	missense	probably benign
R6785:Nostrin	UTSW	2	69183927	missense	probably benign	0.01
R6789:Nostrin	UTSW	2	69175512	missense	probably benign
R7453:Nostrin	UTSW	2	69183896	missense	possibly damaging	0.95
R7465:Nostrin	UTSW	2	69185507	missense	possibly damaging	0.93
R7570:Nostrin	UTSW	2	69175806	missense	probably damaging	0.98
R7761:Nostrin	UTSW	2	69161122	missense	possibly damaging	0.88
R7802:Nostrin	UTSW	2	69189012	missense	probably benign	0.18
R8115:Nostrin	UTSW	2	69180920	critical splice donor site	probably null
R8160:Nostrin	UTSW	2	69179466	missense	probably damaging	0.98
R8844:Nostrin	UTSW	2	69175716	missense	probably damaging	0.99
R9046:Nostrin	UTSW	2	69144779	missense	probably benign
X0021:Nostrin	UTSW	2	69144792	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGGCATATGGGTCCAAATAGG -3'
(R):5'- TGTACCCGTGCATTCCTAAC -3'

Sequencing Primer
(F):5'- CGTAAACACAGAAGGTCTTAGAAATG -3'
(R):5'- AAATTCATTACTCTCAACCAAGAGG -3'

Posted On

2015-09-25