Incidental Mutation 'R0543:Nostrin'
ID50027
Institutional Source Beutler Lab
Gene Symbol Nostrin
Ensembl Gene ENSMUSG00000034738
Gene Namenitric oxide synthase trafficker
SynonymsmDaIP2
MMRRC Submission 038735-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R0543 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69135800-69189330 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to G at 69189131 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamic Acid at position 507 (*507E)
Ref Sequence ENSEMBL: ENSMUSP00000036923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005365] [ENSMUST00000041865] [ENSMUST00000112320] [ENSMUST00000127243] [ENSMUST00000167875]
Predicted Effect probably benign
Transcript: ENSMUST00000005365
SMART Domains Protein: ENSMUSP00000005365
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 148 222 6.3e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000041865
AA Change: *507E
SMART Domains Protein: ENSMUSP00000036923
Gene: ENSMUSG00000034738
AA Change: *507E

DomainStartEndE-ValueType
Pfam:FCH 13 88 4.9e-12 PFAM
low complexity region 135 146 N/A INTRINSIC
coiled coil region 160 190 N/A INTRINSIC
coiled coil region 305 334 N/A INTRINSIC
low complexity region 419 439 N/A INTRINSIC
SH3 441 496 8.89e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112320
SMART Domains Protein: ENSMUSP00000107939
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
Pfam:Spindle_Spc25 150 221 1.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127243
SMART Domains Protein: ENSMUSP00000120142
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
coiled coil region 57 113 N/A INTRINSIC
Pfam:Spindle_Spc25 133 207 4.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141276
Predicted Effect probably benign
Transcript: ENSMUST00000167875
SMART Domains Protein: ENSMUSP00000128039
Gene: ENSMUSG00000005233

DomainStartEndE-ValueType
Pfam:Spindle_Spc25 100 174 1.7e-27 PFAM
Meta Mutation Damage Score 0.8522 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide (NO) is a potent mediator in biologic processes such as neurotransmission, inflammatory response, and vascular homeostasis. NOSTRIN binds the enzyme responsible for NO production, endothelial NO synthase (ENOS; MIM 163729), and triggers the translocation of ENOS from the plasma membrane to vesicle-like subcellular structures, thereby attenuating ENOS-dependent NO production.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired retinal vascular angiogenesis, endothelial cell proliferation, endothelial cell migration and induced neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,289 N110K possibly damaging Het
4930444G20Rik T C 10: 22,066,924 S386G possibly damaging Het
4932438A13Rik G A 3: 36,996,458 S2981N probably benign Het
Alox5 T A 6: 116,454,317 probably null Het
Apol9b A G 15: 77,735,640 N212S probably damaging Het
Ash1l T A 3: 89,063,778 probably null Het
Ccdc180 A T 4: 45,900,041 K200* probably null Het
Ccser2 A T 14: 36,940,192 M345K probably benign Het
Cdcp2 A T 4: 107,097,676 probably null Het
Clca3a1 T C 3: 144,748,394 probably benign Het
Cntn3 G A 6: 102,269,090 probably benign Het
Col28a1 T A 6: 8,075,326 probably benign Het
Dock2 A G 11: 34,294,325 F1035S probably damaging Het
Dsg1a A T 18: 20,340,863 S998C probably damaging Het
Enox1 T C 14: 77,506,959 probably benign Het
Fgfr3 A G 5: 33,729,710 M1V probably null Het
Fuca2 T A 10: 13,503,126 Y5N probably damaging Het
Git2 G T 5: 114,745,531 H42Q probably damaging Het
Gm7964 G A 7: 83,756,394 noncoding transcript Het
Hars2 G A 18: 36,789,424 E337K probably damaging Het
Hells A G 19: 38,967,750 R797G probably benign Het
Hnf1a G A 5: 114,950,744 S571L probably benign Het
Hoxa5 T C 6: 52,204,340 Y4C probably damaging Het
Inpp4a G A 1: 37,369,492 probably benign Het
Ints6 T C 14: 62,696,611 I816V probably damaging Het
Itpr1 T C 6: 108,515,748 probably benign Het
Kcnt2 C A 1: 140,609,614 P1037T probably damaging Het
Lyg2 T A 1: 37,911,107 M47L possibly damaging Het
Macf1 G T 4: 123,376,378 A4648D probably damaging Het
Mcf2l T C 8: 12,996,728 probably null Het
Mcm9 C T 10: 53,541,598 R3H probably damaging Het
Met T A 6: 17,491,970 Y244N probably damaging Het
Mettl14 A T 3: 123,374,762 C210S possibly damaging Het
Mrgpra4 T C 7: 47,981,310 Y181C probably benign Het
Mtch2 T C 2: 90,849,682 V86A possibly damaging Het
Mttp A T 3: 138,111,696 I446N possibly damaging Het
Muc4 T A 16: 32,756,746 S2207T unknown Het
Muc5b A G 7: 141,851,785 T944A unknown Het
Myo15 A T 11: 60,479,051 H879L probably benign Het
Nkiras2 G A 11: 100,624,192 probably benign Het
Nup205 T C 6: 35,198,969 V589A probably benign Het
Olfr1141 C A 2: 87,753,650 L114F probably damaging Het
Olfr1444 G T 19: 12,861,888 V38F probably benign Het
Olfr530 A G 7: 140,373,394 I72T probably benign Het
Oxct2b T A 4: 123,116,989 M234K possibly damaging Het
Park2 G A 17: 11,067,179 D20N probably damaging Het
Pcdha1 A T 18: 37,185,068 I945F probably damaging Het
Pdzd3 A C 9: 44,248,934 H324Q probably damaging Het
Pik3ca G A 3: 32,450,261 probably null Het
Pkhd1l1 A G 15: 44,523,491 probably null Het
Plscr1 A T 9: 92,258,046 probably null Het
Psd T C 19: 46,319,517 E684G possibly damaging Het
Rab11fip3 T C 17: 25,994,225 E870G probably damaging Het
Rpl22l1 C A 3: 28,807,274 Y103* probably null Het
Slc38a4 A T 15: 97,016,839 N44K possibly damaging Het
Slco6c1 T A 1: 97,127,898 I93F probably damaging Het
Ssfa2 T A 2: 79,644,506 S270T possibly damaging Het
Strip1 G A 3: 107,626,775 T181M possibly damaging Het
Stxbp5l G A 16: 37,208,096 A535V probably damaging Het
Tg A T 15: 66,729,597 Q152L probably benign Het
Thada T C 17: 84,423,163 T1036A probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tns1 T A 1: 73,952,697 T941S probably benign Het
Tppp3 T C 8: 105,468,208 D97G probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Trpm7 T C 2: 126,848,529 I210V probably damaging Het
Ubr1 A G 2: 120,881,093 L1440P probably damaging Het
Utp18 A T 11: 93,875,835 Y317N probably damaging Het
Zdhhc5 T A 2: 84,692,480 probably benign Het
Zfp719 A G 7: 43,589,253 probably null Het
Other mutations in Nostrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nostrin APN 2 69185554 splice site probably benign
IGL00502:Nostrin APN 2 69183992 missense probably benign
IGL00767:Nostrin APN 2 69175775 missense probably benign 0.00
IGL00846:Nostrin APN 2 69185555 splice site probably benign
IGL00912:Nostrin APN 2 69182819 splice site probably benign
IGL02123:Nostrin APN 2 69156109 splice site probably benign
IGL02213:Nostrin APN 2 69183918 missense probably benign 0.25
R0295:Nostrin UTSW 2 69179416 missense probably benign 0.19
R1384:Nostrin UTSW 2 69189062 missense probably benign 0.05
R1501:Nostrin UTSW 2 69158785 missense probably damaging 1.00
R1632:Nostrin UTSW 2 69175734 missense probably benign 0.21
R2012:Nostrin UTSW 2 69144767 splice site probably null
R2140:Nostrin UTSW 2 69166003 missense probably damaging 0.98
R2159:Nostrin UTSW 2 69180922 splice site probably null
R2329:Nostrin UTSW 2 69161094 missense probably damaging 1.00
R2890:Nostrin UTSW 2 69180905 missense probably benign
R4469:Nostrin UTSW 2 69175717 missense probably damaging 0.99
R4607:Nostrin UTSW 2 69183899 missense possibly damaging 0.89
R4608:Nostrin UTSW 2 69183899 missense possibly damaging 0.89
R4684:Nostrin UTSW 2 69183924 missense probably benign 0.00
R4719:Nostrin UTSW 2 69144812 nonsense probably null
R4846:Nostrin UTSW 2 69175579 missense probably damaging 1.00
R4911:Nostrin UTSW 2 69161142 missense possibly damaging 0.87
R4987:Nostrin UTSW 2 69156431 missense probably benign
R5054:Nostrin UTSW 2 69175713 missense possibly damaging 0.82
R5177:Nostrin UTSW 2 69175754 missense possibly damaging 0.83
R6561:Nostrin UTSW 2 69180857 missense probably benign
R6785:Nostrin UTSW 2 69183927 missense probably benign 0.01
R6789:Nostrin UTSW 2 69175512 missense probably benign
R7453:Nostrin UTSW 2 69183896 missense possibly damaging 0.95
R7465:Nostrin UTSW 2 69185507 missense possibly damaging 0.93
R7570:Nostrin UTSW 2 69175806 missense probably damaging 0.98
R7761:Nostrin UTSW 2 69161122 missense possibly damaging 0.88
R7802:Nostrin UTSW 2 69189012 missense probably benign 0.18
X0021:Nostrin UTSW 2 69144792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGTTTGCTTCACCTGAATCAAG -3'
(R):5'- TCCAGTTGCCACCCAAAGCTAGAG -3'

Sequencing Primer
(F):5'- GATGTTACCAAGTAGTTCCCCAG -3'
(R):5'- TTGTCACGGGTAGACAATCTC -3'
Posted On2013-06-12