Incidental Mutation 'R4704:C87977'
ID 356273
Institutional Source Beutler Lab
Gene Symbol C87977
Ensembl Gene ENSMUSG00000046262
Gene Name expressed sequence C87977
Synonyms
MMRRC Submission 041952-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock # R4704 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 144206775-144213318 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 144208592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 193 (I193N)
Ref Sequence ENSEMBL: ENSMUSP00000101383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105753] [ENSMUST00000105754] [ENSMUST00000105755] [ENSMUST00000105757] [ENSMUST00000146836] [ENSMUST00000147855]
AlphaFold A2A958
Predicted Effect probably damaging
Transcript: ENSMUST00000105753
AA Change: I193N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000105754
Predicted Effect probably damaging
Transcript: ENSMUST00000105755
AA Change: I23N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101381
Gene: ENSMUSG00000046262
AA Change: I23N

DomainStartEndE-ValueType
SCOP:d1a4ya_ 52 250 9e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105757
AA Change: I193N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101383
Gene: ENSMUSG00000046262
AA Change: I193N

DomainStartEndE-ValueType
SCOP:d1a4ya_ 222 420 1e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132946
Predicted Effect probably benign
Transcript: ENSMUST00000146836
Predicted Effect probably benign
Transcript: ENSMUST00000147855
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 97% (89/92)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,357,530 M147K probably damaging Het
Abca13 A G 11: 9,276,990 D582G possibly damaging Het
Abca2 T C 2: 25,443,412 L1683P probably damaging Het
Adam39 A G 8: 40,825,796 H408R probably benign Het
Adcy4 A G 14: 55,775,025 S554P possibly damaging Het
Ahnak T G 19: 9,012,258 probably benign Het
Ahnak T C 19: 9,013,181 I3943T probably damaging Het
Alkal2 T A 12: 30,887,196 S109R probably damaging Het
Apobec4 A G 1: 152,756,250 T10A probably benign Het
Arhgef40 A G 14: 52,002,310 N1327S probably damaging Het
Arpc3 A G 5: 122,400,408 M1V probably null Het
Ascc1 A G 10: 60,049,802 Y225C probably damaging Het
Ascc3 A G 10: 50,659,014 I668V probably benign Het
Bdnf T A 2: 109,723,692 M137K possibly damaging Het
Cacna1b T C 2: 24,654,463 D1231G probably damaging Het
Cds2 T A 2: 132,300,602 Y239* probably null Het
Cpped1 G A 16: 11,885,629 probably benign Het
Ctu2 G A 8: 122,479,303 R261Q probably damaging Het
Cux1 A G 5: 136,249,201 V645A probably benign Het
Cyp4f13 A G 17: 32,925,735 C401R probably damaging Het
Dpt T G 1: 164,818,949 Y162* probably null Het
Ednra A G 8: 77,667,963 probably benign Het
Eepd1 A G 9: 25,482,826 T129A probably benign Het
Eif2s1 A G 12: 78,877,170 T134A probably benign Het
Eloa A G 4: 136,011,214 V145A probably benign Het
Enam T A 5: 88,503,791 L1053* probably null Het
Eng T C 2: 32,678,912 S484P probably benign Het
Eogt A T 6: 97,113,852 V442E probably damaging Het
Fam185a C T 5: 21,480,473 probably benign Het
Gm4922 C T 10: 18,784,819 V52I probably benign Het
Gnao1 A G 8: 93,811,376 E14G probably benign Het
Gpr75 C A 11: 30,891,110 A5D probably benign Het
Hbq1b T A 11: 32,287,448 probably benign Het
Hdac7 G A 15: 97,796,216 T724M probably damaging Het
Ifi204 C A 1: 173,760,361 probably benign Het
Ift88 A G 14: 57,480,850 probably benign Het
Irak4 A G 15: 94,566,900 probably null Het
Kalrn T C 16: 34,203,957 D610G probably damaging Het
Kifc2 T C 15: 76,662,977 probably null Het
Kmt2c G A 5: 25,314,027 Q2362* probably null Het
Kntc1 G A 5: 123,811,433 E1956K probably damaging Het
Lama3 T C 18: 12,553,223 V2781A probably benign Het
Lipt2 A G 7: 100,160,327 E207G probably damaging Het
Mag A T 7: 30,909,173 L172Q probably damaging Het
Map1b A T 13: 99,430,475 C1913S unknown Het
Mical3 A G 6: 120,958,688 S1626P probably benign Het
Mslnl G T 17: 25,738,978 W65L possibly damaging Het
Muc20 G T 16: 32,779,074 A3332S possibly damaging Het
Nadk C A 4: 155,585,227 P157T probably benign Het
Nkx2-3 G A 19: 43,612,684 E62K probably damaging Het
Olfr791 T C 10: 129,526,302 L25P possibly damaging Het
Pclo A G 5: 14,676,480 probably benign Het
Pcna-ps2 T A 19: 9,283,422 V15E possibly damaging Het
Plekhg3 G T 12: 76,578,238 G1285W probably damaging Het
Procr A G 2: 155,754,338 S142G probably damaging Het
Ptpn3 A T 4: 57,270,119 N14K possibly damaging Het
Rin1 C A 19: 5,054,990 L693I probably damaging Het
Ripk4 C A 16: 97,746,004 E290* probably null Het
Rnf213 A G 11: 119,440,349 Y2128C probably damaging Het
Saal1 T C 7: 46,699,740 probably benign Het
Selplg T C 5: 113,819,033 D404G probably benign Het
Serpinf1 C A 11: 75,411,041 A263S probably damaging Het
Sgo2b A T 8: 63,927,790 D669E probably damaging Het
Slc30a9 T C 5: 67,342,273 probably benign Het
Sri A T 5: 8,062,430 probably null Het
Sspo G A 6: 48,498,704 C4918Y probably damaging Het
Szt2 A G 4: 118,393,829 Y361H probably damaging Het
Tbc1d12 T A 19: 38,901,337 W404R probably damaging Het
Tcf20 T C 15: 82,851,727 E1841G possibly damaging Het
Tep1 T C 14: 50,837,073 T1832A probably benign Het
Tmem132e G A 11: 82,443,531 A623T probably damaging Het
Tmem201 A T 4: 149,727,317 F357Y possibly damaging Het
Trappc13 T G 13: 104,166,821 probably benign Het
Trav6-5 C T 14: 53,491,426 Q47* probably null Het
Ubxn1 T A 19: 8,872,035 D47E probably benign Het
Vmn2r45 G T 7: 8,483,536 S251* probably null Het
Wnk1 A G 6: 119,965,744 L774S possibly damaging Het
Zfp189 T C 4: 49,530,081 S395P probably damaging Het
Other mutations in C87977
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:C87977 APN 4 144208475 missense possibly damaging 0.58
IGL02950:C87977 APN 4 144212961 missense probably benign 0.06
IGL03174:C87977 APN 4 144208430 missense probably benign
IGL03178:C87977 APN 4 144208251 critical splice donor site probably null
PIT4812001:C87977 UTSW 4 144209516 missense probably benign
R0622:C87977 UTSW 4 144213013 unclassified probably benign
R0634:C87977 UTSW 4 144209340 critical splice donor site probably null
R1127:C87977 UTSW 4 144207124 missense probably damaging 1.00
R1341:C87977 UTSW 4 144207559 missense probably damaging 1.00
R1697:C87977 UTSW 4 144208592 missense probably damaging 1.00
R1827:C87977 UTSW 4 144209610 missense probably damaging 0.99
R1857:C87977 UTSW 4 144208521 missense possibly damaging 0.74
R2859:C87977 UTSW 4 144209622 missense probably benign 0.11
R4063:C87977 UTSW 4 144208695 missense possibly damaging 0.87
R4114:C87977 UTSW 4 144209603 missense probably damaging 1.00
R4130:C87977 UTSW 4 144208809 missense probably damaging 0.99
R4255:C87977 UTSW 4 144207484 missense possibly damaging 0.68
R4840:C87977 UTSW 4 144208574 missense probably damaging 0.98
R5267:C87977 UTSW 4 144213005 unclassified probably benign
R5670:C87977 UTSW 4 144209622 missense probably benign 0.11
R6149:C87977 UTSW 4 144207413 missense probably damaging 0.98
R6508:C87977 UTSW 4 144207601 nonsense probably null
R6528:C87977 UTSW 4 144208811 missense probably damaging 0.99
R7252:C87977 UTSW 4 144212940 missense possibly damaging 0.95
R7564:C87977 UTSW 4 144212955 missense probably damaging 1.00
R7704:C87977 UTSW 4 144208521 missense possibly damaging 0.74
R8737:C87977 UTSW 4 144208622 missense probably damaging 1.00
Z1176:C87977 UTSW 4 144207461 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTCATCAAGCTTTTCAGAATCACC -3'
(R):5'- TGAAGGCTTACCAGAGTTCAC -3'

Sequencing Primer
(F):5'- CTTTTCAGAATCACCAAAACTGGAGG -3'
(R):5'- GGCTTACCAGAGTTCACGACAG -3'
Posted On 2015-10-21