Incidental Mutation 'R4752:Prl3c1'
ID357694
Institutional Source Beutler Lab
Gene Symbol Prl3c1
Ensembl Gene ENSMUSG00000017922
Gene Nameprolactin family 3, subfamily c, member 1
SynonymsPrlpj, PLP-J, PLP I
MMRRC Submission 042032-MU
Accession Numbers

Genbank: NM_013766, NM_001163218

Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4752 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location27196659-27203749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27203525 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 164 (K164N)
Ref Sequence ENSEMBL: ENSMUSP00000136890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018066] [ENSMUST00000110364] [ENSMUST00000178072]
Predicted Effect probably benign
Transcript: ENSMUST00000018066
AA Change: K184N

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018066
Gene: ENSMUSG00000017922
AA Change: K184N

DomainStartEndE-ValueType
Pfam:Hormone_1 16 212 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110364
AA Change: K164N

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105993
Gene: ENSMUSG00000017922
AA Change: K164N

DomainStartEndE-ValueType
Pfam:Hormone_1 2 192 2.9e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178072
AA Change: K164N

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136890
Gene: ENSMUSG00000017922
AA Change: K164N

DomainStartEndE-ValueType
Pfam:Hormone_1 2 192 2.9e-31 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced female fertility and a male reproductive tract phenotype that includes enlarged testes and seminal vesicles, increased sperm count, increased serum testosterone and luteinizing hormone levels, and abnormal adult Leydig cell differentiation. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C A 3: 138,069,990 Q1647K possibly damaging Het
Abcf3 A G 16: 20,550,576 E236G probably damaging Het
Adamts17 A G 7: 67,004,470 T483A probably damaging Het
Ankrd26 G T 6: 118,540,465 P465Q probably null Het
Babam2 C T 5: 31,702,047 probably benign Het
Bpifb1 T A 2: 154,216,280 probably benign Het
Ccnb1ip1 T A 14: 50,793,665 T64S possibly damaging Het
Cdhr3 A G 12: 33,086,103 V46A probably damaging Het
Cep170 A T 1: 176,756,688 D708E probably benign Het
Cpsf6 A T 10: 117,361,368 probably benign Het
Cryzl2 C T 1: 157,458,649 probably null Het
Dgka A T 10: 128,736,659 F42I probably benign Het
Dip2a A T 10: 76,276,657 V1059E probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dock4 T A 12: 40,446,365 I3K probably benign Het
Dsc2 A T 18: 20,038,222 N573K probably damaging Het
Eif2b4 G A 5: 31,191,231 R213* probably null Het
Eif3b A G 5: 140,441,101 D704G probably benign Het
Epn2 T C 11: 61,546,371 E125G probably damaging Het
F830016B08Rik A G 18: 60,301,081 N412S probably benign Het
Fbln2 A G 6: 91,256,243 M570V probably benign Het
Gm16686 A T 4: 88,755,488 probably benign Het
Hook2 C T 8: 85,002,720 Q632* probably null Het
Ipcef1 A T 10: 6,979,573 W56R probably damaging Het
Krt78 T C 15: 101,948,202 I418M probably benign Het
Limk1 G A 5: 134,670,441 T154I probably damaging Het
Lyl1 A T 8: 84,704,281 T271S probably benign Het
Megf6 A G 4: 154,252,438 I333V probably damaging Het
Meioc A G 11: 102,674,433 T236A probably benign Het
Nbas A G 12: 13,482,537 T1749A possibly damaging Het
Nfib T A 4: 82,296,779 Q529L probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nisch A T 14: 31,192,588 F42L probably damaging Het
Nomo1 T A 7: 46,057,202 Y547N probably damaging Het
Olfr1157 A G 2: 87,962,349 L181P probably damaging Het
Olfr1512 C T 14: 52,372,307 V249I probably damaging Het
Olfr538 T C 7: 140,574,602 S150P possibly damaging Het
Olfr919 T C 9: 38,697,970 Y136C probably damaging Het
Park2 T C 17: 12,004,123 S387P probably benign Het
Pcdh18 T A 3: 49,755,114 N117I probably damaging Het
Prr23a3 T A 9: 98,865,647 L218Q probably damaging Het
Prss43 A G 9: 110,827,768 H114R possibly damaging Het
Ptcd3 A T 6: 71,901,312 M142K probably damaging Het
Shisa7 G A 7: 4,834,250 T89I possibly damaging Het
Slco1a1 C T 6: 141,946,614 A9T possibly damaging Het
Srcap C T 7: 127,559,000 probably benign Het
Tdg-ps G A 15: 82,516,371 noncoding transcript Het
Tgm4 A G 9: 123,051,386 D284G probably damaging Het
Tmc1 T A 19: 20,826,649 I355F probably benign Het
Tmem121b A T 6: 120,493,034 F241I possibly damaging Het
Tmem200c T A 17: 68,842,240 V606E probably benign Het
Ttc39c A G 18: 12,728,725 K370R probably benign Het
Vmn2r87 G A 10: 130,478,467 Q417* probably null Het
Vps45 T C 3: 96,048,387 Y97C possibly damaging Het
Zfp407 A G 18: 84,562,914 S25P probably benign Het
Zfp566 A G 7: 30,077,881 S292P probably damaging Het
Other mutations in Prl3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Prl3c1 APN 13 27200763 missense probably damaging 0.97
IGL00567:Prl3c1 APN 13 27200712 missense possibly damaging 0.82
IGL01105:Prl3c1 APN 13 27202425 missense probably benign 0.04
IGL02985:Prl3c1 APN 13 27199387 missense probably damaging 0.99
IGL03013:Prl3c1 APN 13 27199366 missense probably benign 0.01
H8930:Prl3c1 UTSW 13 27200706 nonsense probably null
R0437:Prl3c1 UTSW 13 27199464 missense probably benign 0.09
R0630:Prl3c1 UTSW 13 27200691 splice site probably benign
R1277:Prl3c1 UTSW 13 27203572 missense probably damaging 1.00
R2064:Prl3c1 UTSW 13 27196737 critical splice donor site probably null
R2121:Prl3c1 UTSW 13 27199342 unclassified probably null
R4959:Prl3c1 UTSW 13 27202488 splice site probably null
R5863:Prl3c1 UTSW 13 27203610 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGCACAATCACATGTATGGAAATCC -3'
(R):5'- TGCTGCAGGAACTCAAGGAATTG -3'

Sequencing Primer
(F):5'- CACATATATGTACACAGAGAGAGAGC -3'
(R):5'- GGAACTCAAGGAATTGACAACTATTC -3'
Posted On2015-11-11