Incidental Mutation 'R4826:Slc5a1'
List |< first << previous [record 55 of 60] next >> last >|
ID374138
Institutional Source Beutler Lab
Gene Symbol Slc5a1
Ensembl Gene ENSMUSG00000011034
Gene Namesolute carrier family 5 (sodium/glucose cotransporter), member 1
SynonymsSglt1, sodium glucose cotransporter 1
MMRRC Submission 042442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R4826 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location33104219-33162870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33159150 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 580 (D580G)
Ref Sequence ENSEMBL: ENSMUSP00000011178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011178]
Predicted Effect probably benign
Transcript: ENSMUST00000011178
AA Change: D580G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000011178
Gene: ENSMUSG00000011034
AA Change: D580G

DomainStartEndE-ValueType
transmembrane domain 26 48 N/A INTRINSIC
Pfam:SSF 58 492 2.6e-174 PFAM
transmembrane domain 526 548 N/A INTRINSIC
low complexity region 620 634 N/A INTRINSIC
transmembrane domain 641 663 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium-dependent glucose transporter (SGLT) family. The encoded integral membrane protein is the primary mediator of dietary glucose and galactose uptake from the intestinal lumen. Mutations in this gene have been associated with glucose-galactose malabsorption. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality unless maintained on a glucose-galatose-free diet, distended intestine, impaired glucose transport across the brush border membrane and impaired renal glucose reabsorption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik G T 18: 12,185,779 probably benign Het
Abca14 A T 7: 120,216,247 R239S probably damaging Het
Acin1 A G 14: 54,664,617 S573P probably damaging Het
Acta2 A T 19: 34,251,823 Y55* probably null Het
Aifm2 T C 10: 61,725,989 M38T probably benign Het
Ank2 C A 3: 126,956,001 V460L probably benign Het
Ap1b1 T C 11: 5,018,043 S185P probably benign Het
Arsj A G 3: 126,438,802 Y399C probably damaging Het
Clec2d T C 6: 129,184,159 V73A probably benign Het
Cntln T G 4: 85,005,044 M582R probably benign Het
Cyp4a10 C T 4: 115,518,344 P8L probably benign Het
Dip2b A G 15: 100,169,281 N555D probably damaging Het
Dusp4 T A 8: 34,818,517 F311I probably damaging Het
Eif4g3 T C 4: 138,177,945 V1245A possibly damaging Het
Ephb3 G A 16: 21,214,995 R23H possibly damaging Het
Ext2 T C 2: 93,762,630 T410A probably benign Het
Fam193a A G 5: 34,436,531 E124G probably damaging Het
Fat4 T A 3: 38,982,957 V3586E probably damaging Het
Frmd4a T C 2: 4,601,297 S611P probably damaging Het
Gcn1l1 A G 5: 115,593,693 T956A probably benign Het
Gm10549 C A 18: 33,470,785 T107K unknown Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Herc6 T A 6: 57,647,087 M614K probably benign Het
Hspg2 T C 4: 137,565,395 C4095R probably damaging Het
Hyal5 T C 6: 24,891,576 I463T possibly damaging Het
Icam5 C T 9: 21,037,803 A817V possibly damaging Het
Igf2r A T 17: 12,701,353 D1366E probably damaging Het
Ints7 G A 1: 191,611,906 V553I probably damaging Het
Iqgap2 T A 13: 95,763,275 I92F probably damaging Het
Itgb1 T A 8: 128,720,308 C435S probably damaging Het
Lrrc71 T C 3: 87,743,308 M216V probably benign Het
Mgam T C 6: 40,680,648 V979A possibly damaging Het
Myh9 A T 15: 77,788,946 Y400* probably null Het
Narfl A G 17: 25,780,332 H240R probably damaging Het
Nbeal1 A G 1: 60,251,342 R1033G possibly damaging Het
Nit1 T C 1: 171,345,598 probably benign Het
Nlrp1c-ps A G 11: 71,242,517 noncoding transcript Het
Nt5c1a T C 4: 123,208,572 V97A probably damaging Het
Olfr1154 T A 2: 87,903,349 D109V probably damaging Het
Olfr358 A G 2: 37,005,333 Y94H probably damaging Het
Olfr43 A G 11: 74,206,331 M295T possibly damaging Het
Olfr46 T A 7: 140,610,319 M51K probably benign Het
Olfr683 G T 7: 105,143,968 N108K probably damaging Het
Pde4a T A 9: 21,192,380 probably null Het
Pkn2 T C 3: 142,809,509 K640R probably damaging Het
Pla2g6 A G 15: 79,308,679 S263P possibly damaging Het
Prkg1 A G 19: 31,764,606 S73P possibly damaging Het
Prr27 A C 5: 87,850,966 probably benign Het
Rad54b G T 4: 11,599,753 W319L probably damaging Het
Rassf8 T A 6: 145,816,550 L349H probably damaging Het
Rnf113a2 T A 12: 84,417,614 N93K probably benign Het
Sapcd2 C T 2: 25,372,756 A109V probably benign Het
Slamf9 C A 1: 172,476,441 H118N probably benign Het
Slc37a1 A G 17: 31,322,173 Y213C probably damaging Het
Slc7a2 T A 8: 40,911,046 I432N probably damaging Het
Tas2r114 A T 6: 131,689,837 L76Q probably damaging Het
Tcerg1 C T 18: 42,535,115 P391L unknown Het
Tdrd12 A C 7: 35,504,157 V314G probably benign Het
Zbtb7b A G 3: 89,380,773 L246S probably benign Het
Other mutations in Slc5a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Slc5a1 APN 5 33160865 missense probably benign
IGL01872:Slc5a1 APN 5 33154637 missense probably damaging 0.97
IGL01906:Slc5a1 APN 5 33154653 missense probably damaging 1.00
IGL02614:Slc5a1 APN 5 33154601 missense probably benign 0.02
IGL03241:Slc5a1 APN 5 33133405 missense probably benign 0.00
IGL03336:Slc5a1 APN 5 33146943 missense probably benign 0.24
R0314:Slc5a1 UTSW 5 33146651 missense probably benign 0.02
R0421:Slc5a1 UTSW 5 33134652 missense probably damaging 1.00
R0755:Slc5a1 UTSW 5 33133389 missense probably benign 0.14
R0791:Slc5a1 UTSW 5 33158077 splice site probably benign
R1506:Slc5a1 UTSW 5 33154708 missense possibly damaging 0.72
R1801:Slc5a1 UTSW 5 33146953 missense probably damaging 1.00
R2143:Slc5a1 UTSW 5 33160796 missense probably benign
R2190:Slc5a1 UTSW 5 33104593 critical splice donor site probably null
R3796:Slc5a1 UTSW 5 33152652 missense probably damaging 1.00
R4423:Slc5a1 UTSW 5 33154674 missense possibly damaging 0.49
R4465:Slc5a1 UTSW 5 33146516 missense possibly damaging 0.89
R4588:Slc5a1 UTSW 5 33145288 missense probably benign 0.01
R4722:Slc5a1 UTSW 5 33146711 missense possibly damaging 0.86
R4934:Slc5a1 UTSW 5 33104514 missense probably benign
R4955:Slc5a1 UTSW 5 33160902 missense probably benign 0.02
R4963:Slc5a1 UTSW 5 33160782 missense probably benign 0.00
R5008:Slc5a1 UTSW 5 33152573 missense possibly damaging 0.75
R5094:Slc5a1 UTSW 5 33158280 missense probably damaging 1.00
R5292:Slc5a1 UTSW 5 33158241 missense probably benign
R5654:Slc5a1 UTSW 5 33146611 missense probably benign 0.00
R6784:Slc5a1 UTSW 5 33158116 missense probably benign 0.00
R7585:Slc5a1 UTSW 5 33160944 missense probably damaging 1.00
R7734:Slc5a1 UTSW 5 33160935 missense probably benign
R7751:Slc5a1 UTSW 5 33133417 missense possibly damaging 0.63
R7827:Slc5a1 UTSW 5 33146713 missense probably damaging 1.00
RF020:Slc5a1 UTSW 5 33133429 missense probably damaging 1.00
X0064:Slc5a1 UTSW 5 33134636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAGAGGCCATATTCTTTTCCTTTC -3'
(R):5'- ACTGACTCACTGAGTTCTGCC -3'

Sequencing Primer
(F):5'- GGCCATATTCTTTTCCTTTCTTGATG -3'
(R):5'- GCTGAGAGGTCAAAGTTTCCCATC -3'
Posted On2016-03-01