Incidental Mutation 'R0399:Gpc1'
ID 38028
Institutional Source Beutler Lab
Gene Symbol Gpc1
Ensembl Gene ENSMUSG00000034220
Gene Name glypican 1
Synonyms
MMRRC Submission 038604-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0399 (G1)
Quality Score 131
Status Validated
Chromosome 1
Chromosomal Location 92831645-92860779 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 92857309 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 358 (R358H)
Ref Sequence ENSEMBL: ENSMUSP00000047199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045970]
AlphaFold Q9QZF2
Predicted Effect possibly damaging
Transcript: ENSMUST00000045970
AA Change: R358H

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047199
Gene: ENSMUSG00000034220
AA Change: R358H

DomainStartEndE-ValueType
Pfam:Glypican 11 553 6.2e-228 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190586
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190677
Predicted Effect probably benign
Transcript: ENSMUST00000212504
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a reduced brain size with mild cerebellar patterning defects, but are otherwise viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,959 probably benign Het
6030452D12Rik T C 8: 106,504,542 M120T unknown Het
Actr1a A T 19: 46,385,011 probably null Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Anapc5 A T 5: 122,791,753 V555D probably damaging Het
Aox1 A G 1: 58,068,849 probably null Het
Arhgap30 A G 1: 171,404,816 E343G probably damaging Het
Asap2 C T 12: 21,217,997 T291I possibly damaging Het
Atp5a1 T A 18: 77,781,836 Y439* probably null Het
Auts2 A T 5: 131,440,524 S428T probably benign Het
B3gnt7 T A 1: 86,305,711 C109* probably null Het
C4b C A 17: 34,728,869 Q1657H probably damaging Het
Cadm2 A T 16: 66,747,339 L268* probably null Het
Cep290 G A 10: 100,554,400 probably benign Het
Cep68 T G 11: 20,230,571 I687L probably benign Het
Chd6 T A 2: 161,052,688 D84V probably damaging Het
Clpx A G 9: 65,322,769 T514A probably benign Het
Cox18 A T 5: 90,215,028 C324S probably benign Het
Cryzl2 T C 1: 157,462,016 Y75H probably damaging Het
Cxcr6 C T 9: 123,810,951 A339V possibly damaging Het
Dock1 T C 7: 135,163,442 L1721P probably benign Het
Dstyk T C 1: 132,453,080 probably benign Het
Ehf A G 2: 103,266,870 Y246H probably damaging Het
Epas1 T C 17: 86,805,193 V73A probably benign Het
Filip1 A G 9: 79,818,310 I1009T possibly damaging Het
Glis3 A T 19: 28,298,768 probably benign Het
Gm17333 A T 16: 77,852,790 noncoding transcript Het
Gpr155 A T 2: 73,370,002 I387N possibly damaging Het
Gria1 A G 11: 57,186,027 D83G probably damaging Het
Grid2 A G 6: 64,666,052 I933V probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hook2 A G 8: 84,993,567 probably benign Het
Ift140 T A 17: 25,050,340 S656R possibly damaging Het
Il11ra1 A T 4: 41,766,185 T241S probably benign Het
Kank1 A G 19: 25,411,242 I760V probably benign Het
Kansl1 T C 11: 104,424,132 E360G possibly damaging Het
Klf9 A T 19: 23,142,082 S110C probably damaging Het
Klhl31 A G 9: 77,650,653 N217S probably benign Het
Lct T C 1: 128,300,525 Y1077C probably damaging Het
Lrrc49 A T 9: 60,610,246 probably benign Het
Lrrn1 T A 6: 107,569,120 H626Q probably benign Het
Mmp28 A T 11: 83,451,732 L40Q probably damaging Het
Mroh1 C T 15: 76,452,099 A1530V probably benign Het
Myo1e A G 9: 70,301,793 probably benign Het
Naa25 A T 5: 121,435,490 M761L probably benign Het
Ncln G A 10: 81,488,297 A465V probably damaging Het
Nktr A G 9: 121,731,484 N98S probably damaging Het
Olfr1012 T C 2: 85,759,904 I157M possibly damaging Het
Olfr215 C A 6: 116,582,781 S55I probably benign Het
Olfr651 T A 7: 104,553,369 V150E probably benign Het
Olfr76 G C 19: 12,120,370 A114G possibly damaging Het
Olfr878 G T 9: 37,919,553 A304S possibly damaging Het
Pacsin2 T C 15: 83,386,782 Y222C probably damaging Het
Pcdhb15 C T 18: 37,474,168 T151M possibly damaging Het
Plcz1 C A 6: 140,023,230 V161L possibly damaging Het
Ppp6c G A 2: 39,200,124 probably benign Het
Rhbdf2 T A 11: 116,603,992 Y286F probably benign Het
Rtn3 A T 19: 7,457,876 D231E probably damaging Het
Slc35c2 A C 2: 165,280,895 Y156* probably null Het
Spata46 A G 1: 170,311,537 D35G probably damaging Het
Tmed3 A G 9: 89,702,873 F110L possibly damaging Het
Tmem104 T G 11: 115,201,308 probably benign Het
Tpbg T A 9: 85,844,938 V320E possibly damaging Het
Trib2 T C 12: 15,793,663 D190G probably damaging Het
Tspan2 A G 3: 102,759,385 T26A probably damaging Het
Usp17lb A C 7: 104,841,151 Y190D possibly damaging Het
Utp18 C T 11: 93,880,147 probably benign Het
Utp20 A T 10: 88,820,979 D121E probably damaging Het
Vmn1r80 T A 7: 12,193,317 M118K possibly damaging Het
Vmn1r84 T C 7: 12,361,867 S300G probably benign Het
Other mutations in Gpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Gpc1 APN 1 92857014 missense probably damaging 1.00
IGL01697:Gpc1 APN 1 92858410 missense possibly damaging 0.93
IGL02282:Gpc1 APN 1 92857967 missense probably damaging 1.00
IGL02930:Gpc1 APN 1 92857299 nonsense probably null
IGL03160:Gpc1 APN 1 92857857 missense probably damaging 1.00
PIT4514001:Gpc1 UTSW 1 92857557 missense probably benign 0.05
R0115:Gpc1 UTSW 1 92857499 missense probably damaging 1.00
R0383:Gpc1 UTSW 1 92854983 missense probably damaging 1.00
R0938:Gpc1 UTSW 1 92857309 missense possibly damaging 0.72
R0941:Gpc1 UTSW 1 92857309 missense possibly damaging 0.72
R0942:Gpc1 UTSW 1 92857309 missense possibly damaging 0.72
R2483:Gpc1 UTSW 1 92855938 missense probably benign 0.35
R3749:Gpc1 UTSW 1 92857582 nonsense probably null
R5033:Gpc1 UTSW 1 92857029 missense probably damaging 0.97
R5154:Gpc1 UTSW 1 92857029 missense probably damaging 0.97
R5362:Gpc1 UTSW 1 92854893 missense probably benign 0.00
R5626:Gpc1 UTSW 1 92857119 critical splice donor site probably null
R5693:Gpc1 UTSW 1 92857899 missense probably damaging 1.00
R7268:Gpc1 UTSW 1 92858371 missense possibly damaging 0.76
R7790:Gpc1 UTSW 1 92853449 missense probably benign
R7875:Gpc1 UTSW 1 92855248 critical splice donor site probably null
R9225:Gpc1 UTSW 1 92856020 missense probably damaging 1.00
X0020:Gpc1 UTSW 1 92854981 missense probably benign 0.00
Z1177:Gpc1 UTSW 1 92857486 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCTGACCTATACCTGTGACTGCTG -3'
(R):5'- TTGGCCTCAGAGACCTGTTGGATG -3'

Sequencing Primer
(F):5'- AAGGTGTgtgggggctg -3'
(R):5'- AGACCTGTTGGATGGCAGTC -3'
Posted On 2013-05-23