Incidental Mutation 'R0399:Vmn1r80'
ID38051
Institutional Source Beutler Lab
Gene Symbol Vmn1r80
Ensembl Gene ENSMUSG00000115744
Gene Namevomeronasal 1 receptor 80
SynonymsV1rg3
MMRRC Submission 038604-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R0399 (G1)
Quality Score182
Status Validated
Chromosome7
Chromosomal Location12189286-12203313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12193317 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 118 (M118K)
Ref Sequence ENSEMBL: ENSMUSP00000153967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075053] [ENSMUST00000227205] [ENSMUST00000227471] [ENSMUST00000227755] [ENSMUST00000228028] [ENSMUST00000228578]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075053
AA Change: M118K

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074564
Gene: ENSMUSG00000115744
AA Change: M118K

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 5.4e-11 PFAM
Pfam:7tm_1 23 290 5.3e-7 PFAM
Pfam:V1R 31 298 3e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227205
AA Change: M118K

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227240
Predicted Effect possibly damaging
Transcript: ENSMUST00000227471
AA Change: M118K

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227755
AA Change: M118K

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000228028
AA Change: M118K

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228563
Predicted Effect possibly damaging
Transcript: ENSMUST00000228578
AA Change: M118K

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.4%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,750,959 probably benign Het
6030452D12Rik T C 8: 106,504,542 M120T unknown Het
Actr1a A T 19: 46,385,011 probably null Het
AI314180 T C 4: 58,827,047 T1029A possibly damaging Het
Anapc5 A T 5: 122,791,753 V555D probably damaging Het
Aox1 A G 1: 58,068,849 probably null Het
Arhgap30 A G 1: 171,404,816 E343G probably damaging Het
Asap2 C T 12: 21,217,997 T291I possibly damaging Het
Atp5a1 T A 18: 77,781,836 Y439* probably null Het
Auts2 A T 5: 131,440,524 S428T probably benign Het
B3gnt7 T A 1: 86,305,711 C109* probably null Het
C4b C A 17: 34,728,869 Q1657H probably damaging Het
Cadm2 A T 16: 66,747,339 L268* probably null Het
Cep290 G A 10: 100,554,400 probably benign Het
Cep68 T G 11: 20,230,571 I687L probably benign Het
Chd6 T A 2: 161,052,688 D84V probably damaging Het
Clpx A G 9: 65,322,769 T514A probably benign Het
Cox18 A T 5: 90,215,028 C324S probably benign Het
Cryzl2 T C 1: 157,462,016 Y75H probably damaging Het
Cxcr6 C T 9: 123,810,951 A339V possibly damaging Het
Dock1 T C 7: 135,163,442 L1721P probably benign Het
Dstyk T C 1: 132,453,080 probably benign Het
Ehf A G 2: 103,266,870 Y246H probably damaging Het
Epas1 T C 17: 86,805,193 V73A probably benign Het
Filip1 A G 9: 79,818,310 I1009T possibly damaging Het
Glis3 A T 19: 28,298,768 probably benign Het
Gm17333 A T 16: 77,852,790 noncoding transcript Het
Gpc1 G A 1: 92,857,309 R358H possibly damaging Het
Gpr155 A T 2: 73,370,002 I387N possibly damaging Het
Gria1 A G 11: 57,186,027 D83G probably damaging Het
Grid2 A G 6: 64,666,052 I933V probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hook2 A G 8: 84,993,567 probably benign Het
Ift140 T A 17: 25,050,340 S656R possibly damaging Het
Il11ra1 A T 4: 41,766,185 T241S probably benign Het
Kank1 A G 19: 25,411,242 I760V probably benign Het
Kansl1 T C 11: 104,424,132 E360G possibly damaging Het
Klf9 A T 19: 23,142,082 S110C probably damaging Het
Klhl31 A G 9: 77,650,653 N217S probably benign Het
Lct T C 1: 128,300,525 Y1077C probably damaging Het
Lrrc49 A T 9: 60,610,246 probably benign Het
Lrrn1 T A 6: 107,569,120 H626Q probably benign Het
Mmp28 A T 11: 83,451,732 L40Q probably damaging Het
Mroh1 C T 15: 76,452,099 A1530V probably benign Het
Myo1e A G 9: 70,301,793 probably benign Het
Naa25 A T 5: 121,435,490 M761L probably benign Het
Ncln G A 10: 81,488,297 A465V probably damaging Het
Nktr A G 9: 121,731,484 N98S probably damaging Het
Olfr1012 T C 2: 85,759,904 I157M possibly damaging Het
Olfr215 C A 6: 116,582,781 S55I probably benign Het
Olfr651 T A 7: 104,553,369 V150E probably benign Het
Olfr76 G C 19: 12,120,370 A114G possibly damaging Het
Olfr878 G T 9: 37,919,553 A304S possibly damaging Het
Pacsin2 T C 15: 83,386,782 Y222C probably damaging Het
Pcdhb15 C T 18: 37,474,168 T151M possibly damaging Het
Plcz1 C A 6: 140,023,230 V161L possibly damaging Het
Ppp6c G A 2: 39,200,124 probably benign Het
Rhbdf2 T A 11: 116,603,992 Y286F probably benign Het
Rtn3 A T 19: 7,457,876 D231E probably damaging Het
Slc35c2 A C 2: 165,280,895 Y156* probably null Het
Spata46 A G 1: 170,311,537 D35G probably damaging Het
Tmed3 A G 9: 89,702,873 F110L possibly damaging Het
Tmem104 T G 11: 115,201,308 probably benign Het
Tpbg T A 9: 85,844,938 V320E possibly damaging Het
Trib2 T C 12: 15,793,663 D190G probably damaging Het
Tspan2 A G 3: 102,759,385 T26A probably damaging Het
Usp17lb A C 7: 104,841,151 Y190D possibly damaging Het
Utp18 C T 11: 93,880,147 probably benign Het
Utp20 A T 10: 88,820,979 D121E probably damaging Het
Vmn1r84 T C 7: 12,361,867 S300G probably benign Het
Other mutations in Vmn1r80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Vmn1r80 APN 7 12193380 missense possibly damaging 0.69
IGL01652:Vmn1r80 APN 7 12193136 missense probably benign 0.19
IGL02102:Vmn1r80 APN 7 12193691 missense probably damaging 1.00
IGL02165:Vmn1r80 APN 7 12193452 missense probably benign 0.31
IGL02328:Vmn1r80 APN 7 12193478 missense probably benign 0.12
IGL02336:Vmn1r80 APN 7 12193254 missense probably benign 0.23
IGL02606:Vmn1r80 APN 7 12193032 missense probably damaging 1.00
R0310:Vmn1r80 UTSW 7 12193848 missense probably benign 0.00
R1983:Vmn1r80 UTSW 7 12193661 missense probably benign 0.01
R2079:Vmn1r80 UTSW 7 12193194 missense probably damaging 1.00
R4278:Vmn1r80 UTSW 7 12193527 missense probably benign 0.00
R4501:Vmn1r80 UTSW 7 12193391 missense probably benign 0.39
R5894:Vmn1r80 UTSW 7 12193727 missense probably damaging 0.99
R5991:Vmn1r80 UTSW 7 12193496 missense probably benign 0.09
R6552:Vmn1r80 UTSW 7 12193757 missense probably damaging 0.98
R7560:Vmn1r80 UTSW 7 12193823 missense probably damaging 0.98
R7659:Vmn1r80 UTSW 7 12193050 missense probably damaging 1.00
R8313:Vmn1r80 UTSW 7 12193067 missense probably benign 0.00
Z1189:Vmn1r80 UTSW 7 12193433 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCATTCCACAGACACTGTCAG -3'
(R):5'- TGAATAGGCCATGAGACCCAGACAC -3'

Sequencing Primer
(F):5'- TTCCACAGACACTGTCAGATTACG -3'
(R):5'- CAGTTGCAAAGTTGCCTGAAG -3'
Posted On2013-05-23