Incidental Mutation 'R4931:Nanog'
ID380555
Institutional Source Beutler Lab
Gene Symbol Nanog
Ensembl Gene ENSMUSG00000012396
Gene NameNanog homeobox
Synonyms2410002E02Rik, ecat4, ENK
MMRRC Submission 042532-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4931 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location122707489-122714633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122707906 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 17 (A17T)
Ref Sequence ENSEMBL: ENSMUSP00000108200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012540] [ENSMUST00000112580] [ENSMUST00000112581]
Predicted Effect probably benign
Transcript: ENSMUST00000012540
AA Change: A42T

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000012540
Gene: ENSMUSG00000012396
AA Change: A42T

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
HOX 96 158 5.33e-22 SMART
low complexity region 206 230 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112580
AA Change: A17T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108199
Gene: ENSMUSG00000012396
AA Change: A17T

DomainStartEndE-ValueType
HOX 71 133 5.33e-22 SMART
low complexity region 181 205 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112581
AA Change: A17T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108200
Gene: ENSMUSG00000012396
AA Change: A17T

DomainStartEndE-ValueType
HOX 71 133 5.33e-22 SMART
low complexity region 181 205 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency 95% (78/82)
MGI Phenotype FUNCTION: The protein encoded by this gene is a DNA binding homeobox transcription factor involved in embryonic stem (ES) cell proliferation, renewal, and pluripotency. The encoded protein can block ES cell differentiation and can also autorepress its own expression in differentiating cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a disruption in this gene die between E3.5 and E5.5 with abnormal embryonic and extraembryonic tissue development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik A G 3: 145,938,120 D21G probably benign Het
4930402H24Rik A G 2: 130,741,873 F496L possibly damaging Het
4930562C15Rik T C 16: 4,861,046 L68P possibly damaging Het
Ache A G 5: 137,291,914 I414V probably benign Het
Acy1 G A 9: 106,433,191 H308Y probably damaging Het
AF529169 T C 9: 89,601,652 H564R probably benign Het
Aldh1b1 A C 4: 45,803,661 I400L probably benign Het
Ankrd40 T A 11: 94,334,821 L226Q probably benign Het
B3gnt9 T C 8: 105,254,244 T171A probably benign Het
Ccdc33 T C 9: 58,069,851 Y289C probably damaging Het
Cd209f A T 8: 4,103,688 I187N probably damaging Het
Cers6 T G 2: 69,105,112 S319A probably damaging Het
Chrna4 A G 2: 181,028,872 S364P probably benign Het
Chrnb3 T C 8: 27,394,230 S317P probably damaging Het
Dapk1 T C 13: 60,760,960 V1129A probably benign Het
Dhx9 G A 1: 153,472,673 P302L probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Duox2 T C 2: 122,296,755 N147S probably benign Het
Dytn T G 1: 63,633,678 E522A probably benign Het
E130114P18Rik T C 4: 97,720,287 D27G unknown Het
Egf A G 3: 129,711,468 F118S probably damaging Het
Eif2d T A 1: 131,154,391 F73L probably damaging Het
Eps8l1 A G 7: 4,471,241 E237G possibly damaging Het
Espl1 A G 15: 102,305,730 E664G probably benign Het
Fbrsl1 A T 5: 110,379,029 S373T possibly damaging Het
Fras1 T A 5: 96,636,840 F894Y probably benign Het
Gm12800 T C 4: 101,909,170 V17A possibly damaging Het
Gpatch8 T C 11: 102,481,224 E496G unknown Het
Gucy1a2 A G 9: 3,759,588 K465E probably damaging Het
Igdcc4 A G 9: 65,124,015 T459A possibly damaging Het
Itgad A T 7: 128,204,625 I64F probably damaging Het
Itgb2l T A 16: 96,437,449 N50I probably damaging Het
Kif13a A G 13: 46,809,055 I478T probably damaging Het
Krt31 G A 11: 100,050,157 T109I probably benign Het
Ltbr G T 6: 125,307,474 probably null Het
Magel2 A G 7: 62,380,624 D1092G unknown Het
Mindy3 A T 2: 12,396,213 N231K probably damaging Het
Mpnd T G 17: 56,012,362 probably benign Het
Mtus2 C T 5: 148,077,416 L340F probably benign Het
Ndufa9 G T 6: 126,836,320 A181E probably damaging Het
Olfr619 T G 7: 103,604,374 L240R probably benign Het
Olfr869 A T 9: 20,137,562 I149F probably benign Het
Pprc1 ATCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTC 19: 46,071,316 probably benign Het
Prkacb T C 3: 146,747,977 I211V possibly damaging Het
Ptpn14 C G 1: 189,851,277 L774V probably benign Het
Rad1 T C 15: 10,492,762 probably benign Het
Rims1 G T 1: 22,533,947 P391Q probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sf3b3 C T 8: 110,816,329 R832Q probably benign Het
Slc12a2 A G 18: 57,934,963 D975G possibly damaging Het
Slitrk6 A G 14: 110,750,379 L632P probably damaging Het
Spire2 A G 8: 123,368,784 D542G possibly damaging Het
Sppl3 A T 5: 115,082,314 Q95L probably damaging Het
Stat5b C A 11: 100,784,254 E710* probably null Het
Tcl1 G T 12: 105,222,613 H14N probably damaging Het
Ten1 T C 11: 116,205,729 F70L probably benign Het
Tnfrsf13b A T 11: 61,140,937 T35S possibly damaging Het
Tpcn2 G A 7: 145,267,309 P336L probably benign Het
Trf C A 9: 103,228,048 D22Y probably damaging Het
Ttyh1 A G 7: 4,133,944 probably benign Het
Vmn2r103 A T 17: 19,811,769 I602F probably benign Het
Zfp296 G T 7: 19,579,712 C164F possibly damaging Het
Zfp352 A G 4: 90,224,304 Y227C probably damaging Het
Zfp599 A T 9: 22,258,123 W18R probably damaging Het
Other mutations in Nanog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Nanog APN 6 122711536 critical splice acceptor site probably null
IGL03278:Nanog APN 6 122711745 missense probably damaging 1.00
IGL03387:Nanog APN 6 122711772 missense probably damaging 1.00
R0280:Nanog UTSW 6 122713398 missense probably damaging 0.96
R1443:Nanog UTSW 6 122711775 missense probably damaging 1.00
R2520:Nanog UTSW 6 122713459 missense probably benign 0.08
R3037:Nanog UTSW 6 122713268 missense possibly damaging 0.81
R4486:Nanog UTSW 6 122712717 critical splice donor site probably null
R4770:Nanog UTSW 6 122711591 missense possibly damaging 0.63
R4790:Nanog UTSW 6 122707915 missense probably benign 0.00
R4825:Nanog UTSW 6 122713340 missense probably benign 0.09
R6010:Nanog UTSW 6 122713296 missense probably benign 0.16
R6025:Nanog UTSW 6 122713391 missense possibly damaging 0.94
R7661:Nanog UTSW 6 122713472 missense probably damaging 0.96
R8236:Nanog UTSW 6 122713172 missense probably benign
R8272:Nanog UTSW 6 122711777 missense probably benign 0.00
R8520:Nanog UTSW 6 122713516 missense possibly damaging 0.94
X0065:Nanog UTSW 6 122707793 missense probably benign
Z1176:Nanog UTSW 6 122713231 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATCTTTCCTTCTAGACACTGAG -3'
(R):5'- TAGAAGGCCAACGTATCACCG -3'

Sequencing Primer
(F):5'- ACTGACATGAGTGTGGGT -3'
(R):5'- GGTCAAACTCAGAGGGGTTTCC -3'
Posted On2016-04-15