Mutagenetix > Incidental Mutation

Incidental Mutation 'R4929:Adamts12'

381106

Institutional Source

Beutler Lab

Gene Symbol

Adamts12

Ensembl Gene

ENSMUSG00000047497

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12

Synonyms

AI605170; ADAMTS-12

MMRRC Submission

042530-MU

Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Essential gene?

Probably non essential (E-score: 0.088) question?

Stock #

R4929 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11064790-11349231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 11259022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 551 (R551C)

Ref Sequence

ENSEMBL: ENSMUSP00000057796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061318]

AlphaFold

Q811B3

Predicted Effect

probably damaging
Transcript: ENSMUST00000061318
AA Change: R551C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: R551C

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Pep_M12B_propep	53	197	5.5e-30	PFAM
low complexity region	236	245	N/A	INTRINSIC
Pfam:Reprolysin_5	248	438	1.6e-14	PFAM
Pfam:Reprolysin_4	248	453	6.7e-8	PFAM
Pfam:Reprolysin	250	460	1.2e-27	PFAM
Pfam:Reprolysin_2	268	450	5.5e-11	PFAM
Pfam:Reprolysin_3	272	407	3.5e-10	PFAM
TSP1	549	601	9.29e-14	SMART
Pfam:ADAM_spacer1	706	817	4.8e-36	PFAM
TSP1	831	887	4.66e-5	SMART
TSP1	890	949	2.54e-1	SMART
TSP1	951	1001	8.95e-7	SMART
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC
TSP1	1321	1371	2.22e-2	SMART
TSP1	1372	1431	9.97e-2	SMART
TSP1	1432	1479	1.19e-2	SMART
TSP1	1480	1538	2.63e-4	SMART

Meta Mutation Damage Score

0.1853

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.9%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	A	G	7: 29,574,042		noncoding transcript	Het
Abcd3	A	T	3: 121,768,746		probably null	Het
Adamtsl4	A	G	3: 95,678,005	C818R	probably damaging	Het
Arfgef3	T	A	10: 18,630,851	Q842L	probably benign	Het
Aurka	A	T	2: 172,370,406	V17E	probably benign	Het
Ccdc144b	G	A	3: 36,035,338	L146F	probably damaging	Het
Cdh24	C	T	14: 54,633,516	V132I	probably benign	Het
Cep57l1	T	C	10: 41,745,914	D2G	possibly damaging	Het
Cntn5	T	A	9: 9,976,395		probably null	Het
Col10a1	T	C	10: 34,395,124	I364T	probably benign	Het
Dpp6	G	A	5: 27,049,787	A67T	probably benign	Het
Dym	T	A	18: 75,243,286	V583E	probably damaging	Het
Efcab5	T	G	11: 77,103,383	K1259N	probably benign	Het
Ehbp1	T	G	11: 22,239,169	I78L	possibly damaging	Het
Epha1	C	A	6: 42,364,599	A469S	probably benign	Het
Fam135a	T	C	1: 24,030,000	D596G	probably benign	Het
Filip1	T	C	9: 79,819,747	N530S	probably benign	Het
Grhl2	A	G	15: 37,360,802	N610S	probably benign	Het
Haus6	T	C	4: 86,595,433	I331V	probably benign	Het
Ints2	G	T	11: 86,212,653	N1192K	possibly damaging	Het
Itga5	A	G	15: 103,353,235	V445A	probably benign	Het
Itga9	C	A	9: 118,807,249	D82E	probably damaging	Het
Jam2	G	A	16: 84,822,862		probably benign	Het
Klhl32	T	A	4: 24,709,030	I112F	probably damaging	Het
Lepr	A	G	4: 101,815,117	I1113V	probably benign	Het
Lrrc3b	C	A	14: 15,357,888	L239F	probably damaging	Het
Lzic	T	A	4: 149,488,128		probably null	Het
Mxra8	T	A	4: 155,842,661	F351I	probably damaging	Het
Naa40	A	G	19: 7,229,982	F126L	probably damaging	Het
Nbeal1	C	T	1: 60,238,654	S733F	probably damaging	Het
Olfr183	A	C	16: 59,000,219	Y178S	probably damaging	Het
Olfr259	A	G	2: 87,108,183	F68S	possibly damaging	Het
Olfr686	A	G	7: 105,204,025	I106T	probably damaging	Het
Olr1	T	C	6: 129,500,081	T74A	probably damaging	Het
Pgam5	A	T	5: 110,265,825	V130D	probably damaging	Het
Pop4	A	G	7: 38,266,149	C115R	probably damaging	Het
Prpf18	A	T	2: 4,624,537		probably null	Het
Psg16	G	A	7: 17,095,106	R205H	possibly damaging	Het
Ptgr1	C	A	4: 58,981,879	A53S	probably benign	Het
Shank2	A	G	7: 144,411,271	D1451G	probably benign	Het
Slfn10-ps	A	G	11: 83,029,519		noncoding transcript	Het
Sox8	G	A	17: 25,570,356	A56V	probably benign	Het
Ssr3	A	G	3: 65,387,754	S113P	probably damaging	Het
Stx16	T	C	2: 174,096,928	Y296H	possibly damaging	Het
Tfcp2	A	T	15: 100,528,489	N60K	probably benign	Het
Thada	T	C	17: 84,444,226	T441A	probably benign	Het
Trf	G	T	9: 103,227,875		probably benign	Het
Vamp2	T	A	11: 69,088,662		probably benign	Het
Vmn2r105	A	T	17: 20,228,018	D181E	probably benign	Het
Vmn2r12	A	T	5: 109,091,678	Y340N	probably damaging	Het
Wasf2	C	A	4: 133,195,859	D493E	unknown	Het
Wdfy4	T	C	14: 33,047,256	D2084G	possibly damaging	Het
Zfp229	T	A	17: 21,746,373	I528N	probably damaging	Het
Zfp703	T	A	8: 26,978,851	V181E	possibly damaging	Het

Other mutations in Adamts12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Adamts12	APN	15	11311599	missense	probably benign	0.00
IGL00513:Adamts12	APN	15	11256961	missense	probably benign	0.28
IGL00579:Adamts12	APN	15	11152014	missense	probably benign	0.20
IGL00984:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL01307:Adamts12	APN	15	11237546	missense	possibly damaging	0.88
IGL01314:Adamts12	APN	15	11071853	missense	probably benign	0.30
IGL01353:Adamts12	APN	15	11292005	splice site	probably benign
IGL01373:Adamts12	APN	15	11310730	missense	probably benign	0.00
IGL01522:Adamts12	APN	15	11065159	critical splice donor site	probably null
IGL01589:Adamts12	APN	15	11311237	missense	probably benign	0.26
IGL01715:Adamts12	APN	15	11258096	missense	possibly damaging	0.47
IGL01966:Adamts12	APN	15	11258183	missense	probably damaging	0.98
IGL01994:Adamts12	APN	15	11345594	missense	probably damaging	1.00
IGL02058:Adamts12	APN	15	11215610	missense	probably benign	0.01
IGL02216:Adamts12	APN	15	11241485	missense	possibly damaging	0.63
IGL02252:Adamts12	APN	15	11311015	missense	probably benign	0.01
IGL02336:Adamts12	APN	15	11311245	missense	probably benign	0.02
IGL02445:Adamts12	APN	15	11286712	missense	probably damaging	1.00
IGL03115:Adamts12	APN	15	11263336	missense	probably damaging	1.00
IGL03131:Adamts12	APN	15	11345564	missense	probably damaging	1.00
IGL03161:Adamts12	APN	15	11292082	missense	possibly damaging	0.93
IGL03403:Adamts12	APN	15	11241488	missense	probably damaging	1.00
I2289:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
PIT4677001:Adamts12	UTSW	15	11286810	missense	probably benign	0.33
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0016:Adamts12	UTSW	15	11217829	missense	probably damaging	1.00
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0027:Adamts12	UTSW	15	11285873	missense	probably damaging	0.99
R0028:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0108:Adamts12	UTSW	15	11311098	missense	probably benign	0.08
R0122:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0196:Adamts12	UTSW	15	11071508	missense	probably benign	0.11
R0308:Adamts12	UTSW	15	11311560	missense	probably damaging	0.98
R0335:Adamts12	UTSW	15	11311058	missense	possibly damaging	0.95
R0667:Adamts12	UTSW	15	11215624	missense	probably damaging	1.00
R0729:Adamts12	UTSW	15	11255683	missense	possibly damaging	0.91
R1162:Adamts12	UTSW	15	11277458	critical splice donor site	probably null
R1173:Adamts12	UTSW	15	11071757	missense	probably benign
R1174:Adamts12	UTSW	15	11071757	missense	probably benign
R1319:Adamts12	UTSW	15	11286791	missense	probably benign	0.02
R1344:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1367:Adamts12	UTSW	15	11256894	splice site	probably benign
R1396:Adamts12	UTSW	15	11311472	missense	probably benign	0.01
R1418:Adamts12	UTSW	15	11286804	missense	probably damaging	1.00
R1447:Adamts12	UTSW	15	11263361	missense	probably benign	0.42
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1466:Adamts12	UTSW	15	11311359	missense	probably benign
R1599:Adamts12	UTSW	15	11071711	missense	probably damaging	0.99
R1700:Adamts12	UTSW	15	11152057	missense	probably benign	0.00
R1748:Adamts12	UTSW	15	11241462	missense	probably damaging	0.99
R1826:Adamts12	UTSW	15	11071520	missense	probably benign	0.06
R1870:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1871:Adamts12	UTSW	15	11311154	missense	probably benign	0.06
R1872:Adamts12	UTSW	15	11217880	nonsense	probably null
R1931:Adamts12	UTSW	15	11270599	missense	probably benign	0.00
R2041:Adamts12	UTSW	15	11215735	missense	probably damaging	1.00
R2119:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2120:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2122:Adamts12	UTSW	15	11310579	missense	probably damaging	1.00
R2161:Adamts12	UTSW	15	11215735	missense	probably damaging	0.99
R2655:Adamts12	UTSW	15	11065088	missense	possibly damaging	0.50
R4010:Adamts12	UTSW	15	11286083	missense	possibly damaging	0.69
R4208:Adamts12	UTSW	15	11071754	missense	probably benign
R4666:Adamts12	UTSW	15	11311492	missense	probably benign	0.08
R4731:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4732:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4733:Adamts12	UTSW	15	11270662	missense	probably damaging	1.00
R4766:Adamts12	UTSW	15	11285901	missense	probably benign	0.03
R4877:Adamts12	UTSW	15	11327701	missense	probably damaging	1.00
R5060:Adamts12	UTSW	15	11299968	missense	probably damaging	1.00
R5145:Adamts12	UTSW	15	11285876	missense	probably damaging	1.00
R5191:Adamts12	UTSW	15	11327757	missense	probably benign	0.18
R5492:Adamts12	UTSW	15	11336298	missense	probably benign	0.05
R5580:Adamts12	UTSW	15	11152000	missense	probably benign	0.14
R5645:Adamts12	UTSW	15	11277420	missense	possibly damaging	0.92
R5724:Adamts12	UTSW	15	11286750	missense	probably benign	0.15
R6240:Adamts12	UTSW	15	11285958	missense	probably benign	0.44
R6331:Adamts12	UTSW	15	11241433	missense	probably damaging	1.00
R6381:Adamts12	UTSW	15	11256994	missense	possibly damaging	0.93
R6393:Adamts12	UTSW	15	11255635	missense	probably damaging	0.97
R6419:Adamts12	UTSW	15	11215673	missense	possibly damaging	0.72
R6571:Adamts12	UTSW	15	11065101	missense	probably benign	0.00
R6821:Adamts12	UTSW	15	11152048	missense	probably benign	0.14
R6913:Adamts12	UTSW	15	11215692	missense	probably damaging	1.00
R6973:Adamts12	UTSW	15	11331780	nonsense	probably null
R7188:Adamts12	UTSW	15	11336325	nonsense	probably null
R7290:Adamts12	UTSW	15	11277366	missense	probably benign	0.08
R7307:Adamts12	UTSW	15	11217813	missense	probably damaging	1.00
R7376:Adamts12	UTSW	15	11277339	missense	possibly damaging	0.69
R7419:Adamts12	UTSW	15	11317279	missense	probably benign	0.00
R7484:Adamts12	UTSW	15	11345648	missense	probably benign	0.25
R7562:Adamts12	UTSW	15	11270611	missense	probably benign	0.01
R7653:Adamts12	UTSW	15	11257029	missense	probably benign	0.28
R7696:Adamts12	UTSW	15	11258138	missense	probably damaging	1.00
R7957:Adamts12	UTSW	15	11317212	missense	possibly damaging	0.96
R7980:Adamts12	UTSW	15	11263337	missense	probably damaging	1.00
R7992:Adamts12	UTSW	15	11310818	missense	probably benign
R8032:Adamts12	UTSW	15	11259103	critical splice donor site	probably null
R8109:Adamts12	UTSW	15	11331791	missense	probably benign	0.02
R8402:Adamts12	UTSW	15	11263290	missense	probably damaging	0.96
R8751:Adamts12	UTSW	15	11215727	missense	probably damaging	1.00
R8782:Adamts12	UTSW	15	11237592	missense	probably damaging	1.00
R8934:Adamts12	UTSW	15	11299929	missense	probably damaging	0.99
R8952:Adamts12	UTSW	15	11285979	missense	probably damaging	1.00
R8963:Adamts12	UTSW	15	11317357	critical splice donor site	probably null
R9042:Adamts12	UTSW	15	11152048	missense	probably benign	0.08
R9162:Adamts12	UTSW	15	11311635	missense	probably benign	0.29
R9190:Adamts12	UTSW	15	11336360	missense	probably benign	0.02
R9700:Adamts12	UTSW	15	11311356	missense	probably benign	0.04
R9748:Adamts12	UTSW	15	11310542	missense	probably damaging	0.99
V1662:Adamts12	UTSW	15	11071808	missense	probably benign	0.13
X0022:Adamts12	UTSW	15	11277448	missense	probably benign	0.30
Z1176:Adamts12	UTSW	15	11336383	missense	not run
Z1177:Adamts12	UTSW	15	11317324	missense	probably damaging	1.00
Z1177:Adamts12	UTSW	15	11336383	missense	not run

Predicted Primers

PCR Primer
(F):5'- TGTGGCCCCTGATGTATTGC -3'
(R):5'- GACTTCAGTGCCAAGTTAAAACATG -3'

Sequencing Primer
(F):5'- CCCCTGATGTATTGCTGTAAATG -3'
(R):5'- GAATTGTTCAGCATTTTCTCAGAACC -3'

Posted On

2016-04-15