Incidental Mutation 'R4940:Extl2'
ID382983
Institutional Source Beutler Lab
Gene Symbol Extl2
Ensembl Gene ENSMUSG00000027963
Gene Nameexostoses (multiple)-like 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R4940 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location116007462-116029017 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 116027192 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 229 (K229N)
Ref Sequence ENSEMBL: ENSMUSP00000102111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029575] [ENSMUST00000106501] [ENSMUST00000106502]
Predicted Effect probably benign
Transcript: ENSMUST00000029575
AA Change: K229N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000029575
Gene: ENSMUSG00000027963
AA Change: K229N

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
Pfam:Glyco_transf_64 67 321 8.5e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106501
AA Change: K215N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102110
Gene: ENSMUSG00000027963
AA Change: K215N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_transf_64 53 307 1.7e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106502
AA Change: K229N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102111
Gene: ENSMUSG00000027963
AA Change: K229N

DomainStartEndE-ValueType
low complexity region 19 41 N/A INTRINSIC
Pfam:Glyco_transf_64 67 321 1.4e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145945
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased production of heparin sulfate and chondroitin sulfate in mouse embryonic fibroblasts, liver and brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A G 5: 98,737,636 H134R possibly damaging Het
3632451O06Rik A T 14: 49,773,482 M256K probably benign Het
4931414P19Rik T C 14: 54,591,325 T240A probably benign Het
Abca15 T C 7: 120,332,694 Y57H probably benign Het
Adgrf4 A G 17: 42,666,529 I641T possibly damaging Het
Ankrd11 A G 8: 122,889,821 Y2410H probably damaging Het
Apbb2 C A 5: 66,452,261 L14F probably null Het
Arhgdia T C 11: 120,579,235 D204G probably damaging Het
Catsperd A T 17: 56,662,736 Y610F possibly damaging Het
Cblb T A 16: 52,033,103 D27E probably damaging Het
Ccdc180 A T 4: 45,917,453 I893F probably damaging Het
Ccdc180 A G 4: 45,917,508 H911R probably damaging Het
Cdh23 T A 10: 60,307,935 I2966F probably damaging Het
Chat G A 14: 32,419,105 P445L probably damaging Het
Chdh G T 14: 30,032,852 R273L possibly damaging Het
Clic3 T C 2: 25,457,917 V72A probably benign Het
Cyp2d12 T A 15: 82,558,050 D244E probably benign Het
Ddr1 T A 17: 35,690,130 D241V probably damaging Het
Dock7 T A 4: 99,020,077 K605N probably damaging Het
Dsg2 T A 18: 20,579,430 F164I probably damaging Het
Dstyk T A 1: 132,453,106 N446K probably damaging Het
Epb42 A T 2: 121,034,451 L53Q probably damaging Het
Frmd4b T A 6: 97,298,090 S617C probably damaging Het
Fscb C T 12: 64,473,814 V293I probably benign Het
Glp2r G T 11: 67,757,593 Y94* probably null Het
Gm4978 A C 9: 69,450,872 probably benign Het
Gm6729 A G 10: 86,540,388 noncoding transcript Het
Gnat2 A C 3: 108,100,616 N293T probably benign Het
Herpud1 T C 8: 94,390,842 I142T probably benign Het
Irak2 G A 6: 113,693,730 V536I probably benign Het
Kcnu1 A T 8: 25,897,862 probably null Het
Kdm4a A G 4: 118,161,754 S422P probably benign Het
Lair1 T A 7: 4,028,949 D53V probably benign Het
Lhx1 G T 11: 84,519,909 Y196* probably null Het
Lrrc37a G A 11: 103,497,612 T2329I unknown Het
Mag T C 7: 30,909,200 D163G probably damaging Het
Magi3 A G 3: 104,051,392 V459A probably damaging Het
Med13 A G 11: 86,288,118 Y1451H probably damaging Het
Megf8 T A 7: 25,360,706 C2341S probably damaging Het
Mppe1 A G 18: 67,228,024 C221R probably damaging Het
Mtus1 T A 8: 41,041,478 H39L possibly damaging Het
Nkpd1 C T 7: 19,523,573 Q276* probably null Het
Nkx3-1 G A 14: 69,190,918 G72S probably benign Het
Nutm2 T C 13: 50,474,873 C658R possibly damaging Het
Olfm1 T C 2: 28,222,590 V239A possibly damaging Het
Pcnx C T 12: 81,917,793 H245Y possibly damaging Het
Pgm3 A G 9: 86,559,476 L356S probably damaging Het
Pik3r4 C G 9: 105,668,994 H207D probably benign Het
Pkd1l1 T C 11: 8,844,585 T1859A probably benign Het
Pon3 A T 6: 5,221,625 V335E possibly damaging Het
Ppp4r3b A G 11: 29,211,740 T705A probably benign Het
Prmt7 T C 8: 106,237,278 V268A probably benign Het
Psd C T 19: 46,322,417 G398R probably damaging Het
Pygl A G 12: 70,206,381 V188A probably damaging Het
Rnf13 T A 3: 57,796,206 N110K probably damaging Het
Rnf170 C T 8: 26,125,911 Q77* probably null Het
Rrp8 A T 7: 105,734,077 Y327* probably null Het
Ruvbl2 T C 7: 45,424,726 D228G probably damaging Het
Scgn T A 13: 23,989,824 T35S probably benign Het
Scyl3 C T 1: 163,934,747 P74S probably damaging Het
Sec61b T G 4: 47,483,074 S123A probably benign Het
Sertad2 T C 11: 20,647,899 S32P possibly damaging Het
Slc23a3 T C 1: 75,133,803 probably null Het
Sult2a2 T G 7: 13,738,298 V140G probably benign Het
Tbc1d4 A T 14: 101,507,231 S320T probably benign Het
Trabd2b T C 4: 114,408,944 Y52H probably damaging Het
Traf2 T C 2: 25,530,288 E183G probably null Het
Trip10 G T 17: 57,263,017 V561F possibly damaging Het
Ttc7 G T 17: 87,306,958 V184F probably benign Het
Ubc A G 5: 125,386,229 V678A probably benign Het
Unk A G 11: 116,053,665 E414G possibly damaging Het
Usp42 T C 5: 143,719,762 N365D probably damaging Het
Zbtb26 A T 2: 37,436,769 I85K probably damaging Het
Zfhx2 A T 14: 55,066,434 H1364Q possibly damaging Het
Other mutations in Extl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Extl2 APN 3 116027482 missense possibly damaging 0.54
PIT4378001:Extl2 UTSW 3 116010690 start codon destroyed probably null 0.02
R0417:Extl2 UTSW 3 116024357 missense probably benign 0.29
R1500:Extl2 UTSW 3 116027140 missense probably benign 0.33
R2888:Extl2 UTSW 3 116027257 missense probably damaging 1.00
R3836:Extl2 UTSW 3 116024357 missense probably benign 0.29
R4666:Extl2 UTSW 3 116024207 missense probably damaging 1.00
R5261:Extl2 UTSW 3 116027364 missense probably benign 0.19
R6866:Extl2 UTSW 3 116027352 missense probably damaging 0.97
R6866:Extl2 UTSW 3 116027353 missense probably damaging 0.99
R7117:Extl2 UTSW 3 116027439 missense probably damaging 1.00
R7529:Extl2 UTSW 3 116027406 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCCATGTCTGCTCCAAAGAAAC -3'
(R):5'- GTGCCACATTCCGGAATACC -3'

Sequencing Primer
(F):5'- CAGCAATTTCCTGATCAGATCATAGG -3'
(R):5'- AATACCCGTTGGTTTCTTTTTCCAAG -3'
Posted On2016-04-27