Incidental Mutation 'R0437:Daxx'
ID39121
Institutional Source Beutler Lab
Gene Symbol Daxx
Ensembl Gene ENSMUSG00000002307
Gene NameFas death domain-associated protein
Synonyms
MMRRC Submission 038638-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0437 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33909414-33915589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33913624 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 576 (V576A)
Ref Sequence ENSEMBL: ENSMUSP00000133552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053429] [ENSMUST00000079421] [ENSMUST00000170075] [ENSMUST00000172619] [ENSMUST00000173028] [ENSMUST00000173626] [ENSMUST00000174146] [ENSMUST00000174463] [ENSMUST00000174541]
Predicted Effect probably benign
Transcript: ENSMUST00000053429
SMART Domains Protein: ENSMUSP00000057466
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
BTB 57 151 7.21e-22 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 317 355 N/A INTRINSIC
low complexity region 390 403 N/A INTRINSIC
low complexity region 431 443 N/A INTRINSIC
low complexity region 460 479 N/A INTRINSIC
ZnF_C2H2 483 504 1.24e2 SMART
ZnF_C2H2 510 532 1.28e-3 SMART
ZnF_C2H2 538 559 4.69e0 SMART
low complexity region 567 587 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000079421
AA Change: V614A
SMART Domains Protein: ENSMUSP00000078390
Gene: ENSMUSG00000002307
AA Change: V614A

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Daxx 54 152 1.3e-51 PFAM
Blast:KISc 185 261 2e-17 BLAST
PDB:4H9S|F 189 404 1e-131 PDB
SCOP:d1sig__ 437 493 7e-3 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 693 715 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170075
AA Change: V614A
SMART Domains Protein: ENSMUSP00000128504
Gene: ENSMUSG00000002307
AA Change: V614A

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172526
Predicted Effect probably benign
Transcript: ENSMUST00000172619
SMART Domains Protein: ENSMUSP00000134695
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
PDB:3F8U|D 12 119 1e-38 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172859
Predicted Effect probably benign
Transcript: ENSMUST00000173028
SMART Domains Protein: ENSMUSP00000133319
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 137 1.6e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173279
Predicted Effect probably benign
Transcript: ENSMUST00000173626
SMART Domains Protein: ENSMUSP00000133303
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 167 6.8e-74 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174146
AA Change: V614A
SMART Domains Protein: ENSMUSP00000134158
Gene: ENSMUSG00000002307
AA Change: V614A

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174321
Predicted Effect probably benign
Transcript: ENSMUST00000174463
SMART Domains Protein: ENSMUSP00000133345
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Pfam:BTB 47 87 7.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174467
Predicted Effect probably benign
Transcript: ENSMUST00000174541
AA Change: V576A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000133552
Gene: ENSMUSG00000002307
AA Change: V576A

DomainStartEndE-ValueType
Pfam:Daxx 1 702 1.5e-297 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174646
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene display extensive apoptosis and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik A G 2: 91,421,953 L21P probably damaging Het
4833420G17Rik G A 13: 119,470,095 R291K probably benign Het
4932438A13Rik A T 3: 36,989,804 H2820L possibly damaging Het
Abca2 T C 2: 25,442,845 S1519P probably damaging Het
Abcb11 G A 2: 69,257,295 A1042V probably damaging Het
Abcc10 A T 17: 46,312,919 probably null Het
Abcc10 G T 17: 46,312,920 probably benign Het
Alkbh3 A C 2: 93,981,569 L240V probably damaging Het
Apol10b T C 15: 77,585,408 S190G probably benign Het
Atp1a3 C A 7: 24,998,967 C135F probably benign Het
Atp4a C G 7: 30,720,101 R659G probably benign Het
BC030499 T C 11: 78,291,536 L57P probably benign Het
Bicra A G 7: 15,988,762 S277P possibly damaging Het
Bmp8a T C 4: 123,316,897 E275G probably benign Het
Ccdc102a T C 8: 94,913,426 E80G probably damaging Het
Cdh23 T C 10: 60,410,797 D954G probably damaging Het
Chrm4 A G 2: 91,928,443 T399A possibly damaging Het
Clcn3 A G 8: 60,934,537 V199A possibly damaging Het
Crlf1 T C 8: 70,499,514 probably null Het
Crx G T 7: 15,871,146 S57* probably null Het
Cyp4f16 A G 17: 32,537,098 I34V possibly damaging Het
Ddx17 C T 15: 79,537,471 R351H probably damaging Het
Dhx38 T C 8: 109,558,629 probably benign Het
Dnd1 T C 18: 36,764,499 probably benign Het
Dync1i2 A T 2: 71,227,825 probably null Het
E2f6 T C 12: 16,816,445 S52P probably benign Het
Epb41l4a A G 18: 33,880,273 F116S probably damaging Het
Ext1 T C 15: 53,106,106 N362S probably damaging Het
Fam227a C A 15: 79,643,988 K79N possibly damaging Het
Fam228a T A 12: 4,732,759 L111F probably damaging Het
Fat2 T C 11: 55,282,799 T2363A probably benign Het
Fat3 A T 9: 15,996,932 N2591K probably damaging Het
Frem2 A G 3: 53,653,015 M1357T possibly damaging Het
Frmd4b A T 6: 97,423,463 V29D probably damaging Het
G930045G22Rik A G 6: 50,846,938 noncoding transcript Het
Galnt3 A G 2: 66,107,229 S46P possibly damaging Het
Gmeb2 A G 2: 181,253,973 V468A possibly damaging Het
Herc2 C T 7: 56,219,815 R4271* probably null Het
Il5 C A 11: 53,723,906 probably benign Het
Ints9 G A 14: 64,986,369 probably benign Het
Itga10 T C 3: 96,649,137 F196S probably damaging Het
Itgb3bp T C 4: 99,781,889 T138A probably damaging Het
Kcnd1 G A X: 7,824,683 V281M probably benign Het
Lcp2 T C 11: 34,087,229 L391P probably benign Het
Lrrc66 T C 5: 73,607,687 Y671C probably benign Het
Mettl23 T C 11: 116,849,294 V197A possibly damaging Het
Mmp15 C A 8: 95,370,772 D456E probably benign Het
Mospd4 T C 18: 46,465,781 noncoding transcript Het
Mov10l1 C A 15: 89,005,312 H484N probably damaging Het
Mphosph9 T C 5: 124,315,568 Q197R probably benign Het
Ms4a1 T A 19: 11,256,569 probably null Het
Mybbp1a T C 11: 72,448,848 V919A possibly damaging Het
Mycbpap A T 11: 94,513,512 probably benign Het
Naip6 G A 13: 100,296,924 S1135F possibly damaging Het
Ndufc2 T A 7: 97,400,337 M50K probably benign Het
Npr2 T C 4: 43,648,082 V842A probably damaging Het
Ntsr2 G T 12: 16,653,695 G66W probably damaging Het
Obscn T C 11: 58,995,088 probably benign Het
Olfr1206 T A 2: 88,864,885 N93K probably benign Het
Olfr1219 T A 2: 89,074,612 I160F probably benign Het
Olfr427 G A 1: 174,100,399 G314R probably benign Het
Olfr820 T C 10: 130,018,096 V245A probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Otud4 T A 8: 79,669,997 H628Q probably benign Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pex16 G T 2: 92,375,592 R10L probably damaging Het
Pitpnm2 A G 5: 124,131,089 probably benign Het
Pom121l2 A G 13: 21,983,205 T549A possibly damaging Het
Prdm15 A T 16: 97,812,559 M470K probably benign Het
Prkag2 T A 5: 25,028,505 D49V possibly damaging Het
Prl3c1 A G 13: 27,199,464 M38V probably benign Het
Prpf18 T A 2: 4,643,761 I85F possibly damaging Het
Psg27 A G 7: 18,560,711 probably benign Het
Relt A G 7: 100,848,784 probably benign Het
Serpina3b A T 12: 104,130,670 N70I probably damaging Het
Slc19a3 T C 1: 83,022,565 S244G probably benign Het
Slc39a5 T C 10: 128,399,847 T81A possibly damaging Het
Slc7a2 G A 8: 40,904,526 G277D probably damaging Het
Slc9c1 C T 16: 45,599,887 probably benign Het
Slx1b A G 7: 126,692,581 F104L probably benign Het
Smg6 G A 11: 74,929,701 S266N probably damaging Het
Spata9 T C 13: 75,998,495 V162A possibly damaging Het
Szrd1 T C 4: 141,118,744 I47V probably benign Het
Tha1 G T 11: 117,868,575 L363M probably benign Het
Tmc6 G A 11: 117,778,261 T89I possibly damaging Het
Tmem132d C T 5: 127,789,785 G684R probably damaging Het
Trim55 G A 3: 19,670,978 G220S probably benign Het
Ttn A G 2: 76,770,530 L18836P probably damaging Het
Ubn1 G T 16: 5,072,184 probably benign Het
Ush2a T G 1: 188,911,031 W4197G probably benign Het
Vmn1r189 A T 13: 22,102,061 V202E probably damaging Het
Vmn1r209 T C 13: 22,806,356 I55V probably benign Het
Vmn2r86 A T 10: 130,446,543 C735S probably damaging Het
Vwf A T 6: 125,566,318 D174V probably damaging Het
Zfp438 T C 18: 5,214,910 N16S probably damaging Het
Zfp444 C T 7: 6,189,409 T142I probably benign Het
Zfp804a A G 2: 82,053,791 M1V probably null Het
Zfp936 T G 7: 43,189,310 I67S probably benign Het
Zfp948 A T 17: 21,586,998 N151Y unknown Het
Other mutations in Daxx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Daxx APN 17 33911607 nonsense probably null
IGL01066:Daxx APN 17 33913893 missense probably benign 0.43
IGL01622:Daxx APN 17 33913480 missense probably benign
IGL02245:Daxx APN 17 33912377 splice site probably benign
IGL02432:Daxx APN 17 33912337 missense probably benign 0.31
IGL02484:Daxx APN 17 33912242 missense probably damaging 1.00
IGL02992:Daxx APN 17 33911748 missense probably damaging 1.00
R0302:Daxx UTSW 17 33913620 missense probably damaging 1.00
R0356:Daxx UTSW 17 33913893 missense probably benign 0.43
R0635:Daxx UTSW 17 33912644 missense probably benign 0.00
R0932:Daxx UTSW 17 33910661 missense probably damaging 1.00
R1498:Daxx UTSW 17 33912253 missense probably damaging 1.00
R1785:Daxx UTSW 17 33911842 missense probably damaging 1.00
R1996:Daxx UTSW 17 33913611 missense possibly damaging 0.89
R2367:Daxx UTSW 17 33911847 missense probably benign 0.38
R4320:Daxx UTSW 17 33911419 missense probably damaging 1.00
R4321:Daxx UTSW 17 33911406 missense possibly damaging 0.94
R5055:Daxx UTSW 17 33912160 missense probably benign 0.01
R5546:Daxx UTSW 17 33912641 small deletion probably benign
R5547:Daxx UTSW 17 33912641 small deletion probably benign
R5547:Daxx UTSW 17 33912659 small deletion probably benign
R5591:Daxx UTSW 17 33911688 missense probably damaging 1.00
R6317:Daxx UTSW 17 33911975 missense probably damaging 1.00
R6362:Daxx UTSW 17 33911364 missense probably damaging 1.00
R6493:Daxx UTSW 17 33912371 critical splice donor site probably null
R7100:Daxx UTSW 17 33911442 missense probably damaging 1.00
R7176:Daxx UTSW 17 33913318 missense unknown
R7310:Daxx UTSW 17 33910461 missense possibly damaging 0.70
R7418:Daxx UTSW 17 33910605 missense probably benign 0.05
R7476:Daxx UTSW 17 33911281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATGAGAGTCCCACATCGCCTTC -3'
(R):5'- TGGACACTTGTGTTCTGCCCACTG -3'

Sequencing Primer
(F):5'- TTCCATAGAAGGAATTCAGAGCCTG -3'
(R):5'- CGGTTCTTTTATATAGCTAAGGACAG -3'
Posted On2013-05-23